We narrowed to 14,259 results for: crispr grnas
-
Plasmid#153014PurposeA guide RNA targeting ACE2 in a lentiviral plasmid co-expressing Cas9 and TagBFP2DepositorAvailable SinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pCRA03
Plasmid#103141PurposeTriple gRNA expression separated with 28nt Csy4 motifDepositorInsertgRNAs
ExpressionYeastAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OCT4-1-5-PGK-Puro
Plasmid#102893PurposePiggyBac transposon system construct with 5 concatenated U6 promoter driven transcriptional cassettes for the activation of OCT4. Contains PGK-puro selection cassette.DepositorAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS13
Plasmid#107927Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgRosa26
Plasmid#159914PurposeMutagenesis of Rosa26 with SauCas9DepositorInsertRosa26 gRNA (Gt(ROSA)26Sor Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
EKv413(Gold Cas-guide insert4 2 gene version)
Plasmid#248342PurposegRNA insert vector for Golden Gate Assembly, 2 gene or 4 gRNAs versionDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
EKv414(Gold Cas-guide insert6 3 gene version)
Plasmid#248343PurposegRNA insert vector for Golden Gate Assembly, 3 gene or 6 gRNAs versionDepositorTypeEmpty backboneUseCRISPRAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
JD633
Plasmid#160393PurposeCRISPR-Cas9 vector including GRF4-GIF1. For wheat and other monocots CRISPR experiments. Includes two AarI sites for gRNA cloningDepositorInsertsZmUbi::wheat GRF4-GIF1 chimera
ZmUbi:TaCas9 + TaU6:gRNA
UseBinary vectorAvailable SinceDec. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDR348 FANCF
Plasmid#47510Purposehuman gRNA expression vector targeting FANCFDepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 T2 CRIPR in pX330
Plasmid#72833PurposeCRISPR/Cas to target the AAVS1 locus in human cellsDepositorInsertCas9 and gRNA for targeting the AAVS1 locus in human cells
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceFeb. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCR1323
Plasmid#111125PurposeExpresses non-targeting_01224 sgRNA in pCR1068DepositorInsertNon-targeting gRNA
UseLentiviralAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCE27
Plasmid#174405PurposeC. auris LEUpOUT NAT marker gRNA expression construct. Use with pCE35 CAS9 expression construct.DepositorInsertNAT 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterialAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM355
Plasmid#173175Purpose(Empty Backbone) Expresses gRNA-12xMBS from hU6 promoterDepositorInsertgRNA-12xMBS backbone
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE41
Plasmid#174433PurposeC. auris LEUpOUT HYG marker gRNA expression construct. Use with pCE38 CAS9 expression construct.DepositorInsertHYG 2 of 2, pSNR52, ADE2 gRNA, gRNA conserved, C. auris LEU2 2 of 2
UseCRISPRExpressionBacterial and YeastAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM370
Plasmid#173178Purpose(Empty Backbone) gRNA-12xMBSDepositorInsertgRNA-12xMBS
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6T7
Plasmid#71462PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (2 Gs at initiation)DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterhuman U6/phage T7Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6T7G
Plasmid#71463PurposeExpresses gRNA from hybrid human U6/T7 promoter for both cellular expression and in vitro transcription from same promoter (1 G at initiation)DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and MammalianPromoterhuman U6/phage T7Available SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas34
Plasmid#82386PurposesgRNA targeting YFP expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas59
Plasmid#82396PurposesgRNA targeting YFP +787 from TSS; non-template strand; expressed from aTc inducible system in pEZ03 in the NS1 locus with kanamycin resistanceDepositorInsertgRNA
PromoterPEZ3Available SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only