We narrowed to 7,944 results for: RAP
-
Bacterial Strain#61922PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. cyo ilvE avtA aspC hisG argH metA lysA thrC asnA asnB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only
-
ML42
Bacterial Strain#61921PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. cyo ilvE avtA aspC hisG argH metA lysA thrC asnB genes deleted.DepositorBacterial ResistanceNoneAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
ML40K1
Bacterial Strain#61920PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. cyo ilvE avtA aspC hisG argH metA lysA genes. deleted. Contains pACYC plasmid.DepositorBacterial ResistanceChloramphenicolAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
ML12
Bacterial Strain#61910PurposeC43(DE3)-based E. coli amino acid auxotrophic host strains used for selective isotope labeling. ilvE avtA aspC genes deleted.DepositorBacterial ResistanceKanamycinAvailable SinceJan. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
gCH198 (crCD55-4_crB2M-1_crB2M-3_crCLTA-4_crFOLH1-1_crCD151-3_crHBG-3_crKIT-2_crKIT-3_crCD81-1)
Plasmid#217345PurposecrRNA array targeting CD55, B2M, CLTA, FOLH1, CD151, HBG1/HBG2, KIT, CD81DepositorInsertscrCD55-4 gRNA: actggtattgcggagccacgagg (CD55 Human)
crB2M-1 gRNA: atataagtggaggcgtcgcgctg (B2M Human)
crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (B2M Human)
crCLTA-4 gRNA: ggctctgcaacaccgcctagacc (CLTA Human)
crFOLH1-1 gRNA: gctccagacctggggtccagttt (FOLH1 Human)
crCD151-3 gRNA: cgggaggccgcacccaccgcctg (CD151 Human)
crHBG-3 gRNA: ttcttcatccctagccagccgcc (HBG1, HBG2 Human)
crKIT-2 gRNA: tctgcgttctgctcctactgctt (KIT Human)
crKIT-3 gRNA: agctctcgcccaagtgcagcgag (KIT Human)
crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (CD81 Human)
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AiP11390-pAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA (Alias: CN1390)
Plasmid#163505PurposeDLX2.0 (3xCore version of DLX enhancer). AAV vector for strong & rapid SYFP2 expression in forebrain GABAergic interneurons. The enhancer core has 100% seq conservation between mouse and humanDepositorHas ServiceAAV PHP.eBInsertSYFP2
UseAAVPromoterminBetaGlobinAvailable SinceFeb. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
biGBac Kit
Plasmid Kit#1000000088PurposeRapid generation of large baculoviral transfer vectors coding for up to 25 protein complex subunits for expression in baculovirus-infected insect cells.DepositorApplicationGene Expression and LabelingVector TypeInsect ExpressionAvailable SinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
OVC Core Collection
Plasmid Kit#1000000164PurposeUse the Core Optogenetic Vector Collection (OVC) to rapidly generate custom-made optogenetic tools in configurations ABC, BAC, or ACB to regulate protein-protein interactions.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeMammalian ExpressionCloning TypeRestriction EnzymeAvailable SinceOct. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
GreenGate
Plasmid Kit#1000000036PurposePlasmids for rapidly assembling plant transformation constructs, based on the Golden Gate method.DepositorApplicationCloning and Synthetic BiologyVector TypePlant ExpressionCloning TypeGolden Gate (GreenGate)Available SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
4G-Cloning Plasmid Kit
Plasmid Kit#1000000252PurposeUse 4G (Golden-Gate-guided Gibson) cloning for rapid assembly of single- or multi-gene expression vectors for multi-subunit protein complexes in various expression hosts.DepositorApplicationCloning and Synthetic BiologyVector TypeBacterial ExpressionCloning TypeGolden GateAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
IF189
Bacterial Strain#134836PurposeRapid and efficient recombineering and purificiation of modified lambda phage DNADepositorBacterial ResistanceNoneAvailable SinceJan. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
S4197
Bacterial Strain#200839Purposewildtype strain MG1655 rph+, ilvG+, ΔlacZDepositorBacterial ResistanceNoneSpeciesEscherichia coli str. k-12 substr. mg1655Available SinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
Fungal Toolkit for Modular Cloning (FTK)
Plasmid Kit#1000000191PurposeSynthetic biology entry vectors with ready-to-use fungal genetic parts for rapid construction of genetic circuits as well as CRISPR components for efficient genome engineering in filamentous fungi.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypeFungal ExpressionEditing TypeCRISPRCloning TypeGolden GateAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
MutaT7
Bacterial Strain#156460PurposeAn E. coli strain that expresses MutaT7 for mutagenizing genes downstream from a T7 promoter.DepositorBacterial ResistanceStreptomycinSpeciesRattus norvegicusAvailable SinceOct. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
Alexandrov Cell-Free Protein Expression Kit (PEK)
Plasmid Kit#1000000065PurposePlasmids consisting of open reading frames cloned into the pCellFree vector, which enables protein expression in any in vitro translation system.DepositorApplicationGene Expression and LabelingVector TypeIn Vitro ExpressionAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
Fragmid
Plasmid Kit#1000000237PurposeToolkit for rapid creation of CRISPR vectors compatible with various delivery approaches, enzymes, and mechanisms.DepositorApplicationCloning and Synthetic Biology, Genome EditingVector TypeAAV, Insect Expression, Lentiviral, Mammalian ExpressionEditing TypeCRISPRCloning TypeGolden Gate (MoClo)Available SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
MG1655-tMMR
Bacterial Strain#62392PurposeE. coli MG1655 temperature-sensitive mismatch repair deficient strain, harboring mutS(A134V) mutL(G62S), and nadA::Tn10 pglΔ8 [λ cI857 Δ(cro-bioA)]} for λ Red expressionDepositorBacterial ResistanceTetracyclineSpeciesEscherichia coliAvailable SinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
Target Accelerator Lung Cancer Mutant Collection
Plasmid Kit#1000000104PurposeGateway entry vectors containing wildtype and mutant alleles associated with lung adenocarcinoma.DepositorApplicationGene Expression and LabelingVector TypeMammalian ExpressionAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
EH1
Bacterial Strain#102804PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. thrC ilvA genes deleted.DepositorBacterial ResistanceNoneAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
RF17
Bacterial Strain#102801PurposeBL21(DE3)-based E. coli amino acid auxotrophic host strain used for selective isotope labeling. aspC tyrB ilvE genes deleted.DepositorBacterial ResistanceNoneAvailable SinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only