We narrowed to 23,538 results for: Sis;
-
Plasmid#235748PurposeProtein expression of ScVPS34 HELCATDepositorInsertVPS34 HELCAT
ExpressionYeastMutationaa 268-875Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO227
Plasmid#235749PurposeProtein expression of ZZ-FL ScVPS30DepositorInsertVPS30
TagsZZ-3xTEVExpressionYeastAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO832
Plasmid#235755PurposeProtein expression of ScVPS30 (1-215E), untaggedDepositorInsertScVPS30
ExpressionYeastMutationaa 1-215EAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO478
Plasmid#235757PurposeExpression of FL ScVPS34-3xFLAG under its own promoterDepositorInsertVPS34
Tags3xFLAGExpressionYeastPromoterScVPS34 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYO764
Plasmid#235761PurposeExpression of ScVPS38-EGFP under its own promoterDepositorInsertVPS38
TagsEGFPExpressionYeastPromoterScVPS38 promoterAvailable SinceMay 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI-C-term K-R
Plasmid#233092PurposeExpression of GST-YihI with C-term lysines (K) mutated to arginine (R)DepositorInsertGST-YihI with C-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationC-term lysines (K) mutated to arginine (R)Available SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term K-R
Plasmid#233091PurposeExpression of GST-YihI with N-term lysines (K) mutated to arginine (R)DepositorInsertYihI with N-term lysines (K) mutated to arginine (R)
TagsGSTExpressionBacterialMutationN-terminal lysine residues mutated to arginineAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-S1BD
Plasmid#232580PurposeExpression of the Rnr S1 and basic domains (residues 1930 to 2442) as a GST-fusion.DepositorInsertRnr S1 + basic domain (residues 1930 to 2442)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-ND
Plasmid#232579PurposeExpression of the Rnr nuclease domain (residues 649 to 1929) as a GST-fusion.DepositorInsertRnr nuclease domain (residues 649 to 1929)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRnr-CSD
Plasmid#232578PurposeExpression of the Rnr cold shock domains I and II (residues 1 to 648) as a GST-fusion.DepositorInsertRnr cold shock domains I and II (residues 1 to 648)
TagsGSTExpressionBacterialAvailable SinceMay 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYihI-N-term S-A
Plasmid#233096PurposeExpression of GST-YihI with N-term serines (S) mutated to alanine (A)DepositorInsertYihI with N-term serines (S) mutated to alanine (A)
TagsGSTExpressionBacterialMutationN-term serines (S) mutated to alanine (A)Available SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaAinBCDEOT1T2
Plasmid#225056PurposeHeterologous expression in Streptomyces with inactive SnaADepositorInsertinactivated SnaA
ExpressionBacterialMutationS556A/S1616APromoterSP44Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
POSV801-SP44-SnaABCDEinOT1T2
Plasmid#225057PurposeHeterologous expression in Streptomyces with inactive SnaEDepositorInsertinactivated SnaE
ExpressionBacterialMutationdeltaA46-V801PromoterSP44Available SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
JDW 1035 (pME_V5_TCF7L1_P2A_H2A_mCherry)
Plasmid#232125PurposeA middle entry gateway clone containing V5 tagged human TCFL7 / TCF3 and an H2A tagged mCherry, separated by a P2A peptide cleavage sequence.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-KCTD19
Plasmid#222529PurposePiggyBac transposon plasmid for doxycycline inducible expression of KCTD19DepositorAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-DMRTB1
Plasmid#222531PurposePiggyBac transposon plasmid for doxycycline inducible expression of DMRTB1DepositorInsertDMRTB1 (DMRTB1 Human)
ExpressionMammalianAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HOXA5
Plasmid#222538PurposePiggyBac transposon plasmid for doxycycline inducible expression of HOXA5DepositorInsertHOXA5 (HOXA5 Human)
ExpressionMammalianAvailable SinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only