We narrowed to 15,991 results for: LEA
-
Plasmid#223136PurposepCMV and pT7 Human expression plasmid for PEmax(nSpCas9(H840A)-M-MMLV_RT**)-P2A-EGFPDepositorInserthuman codon optimized PEmax-P2A-EGFP
UseCRISPRTagsBPNLS and NLS(SV40)-NLS(cMyc)-P2A-EGFPExpressionMammalianMutationM-MLV mutations from PE2 (Anzalone et al. Nature …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIG-FGF13A
Plasmid#220793PurposeTo express the human FGF13 isoform 1(FGF13A) in mammalian cells together with EGFPDepositorInsertFGF13 (FGF13 Human)
Available SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBactin-AcGFP-128-425-Akap9
Plasmid#196871PurposeExpression of fragment 128-425 from A-Kinase Anchoring Protein 9 (Akap9) fused to AcGFP. Used to displace endogenous Akap9 from GolgiDepositorInsertAcGFP-Akap9 (128-425) (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBactin-PACT-mOrange2-hCM1
Plasmid#196868PurposeExpression of Pericentrin-AKAP450 centrosomal targeting (PACT) domain fused to mOrange2 and human (h) Centrosomin motif 1 (CM1). PACT targets CM1 to the centrosomeDepositorInsertPACT-mOrange2-hCM1 (Akap9 Rat)
ExpressionMammalianPromoterChicken bactin (plus Chicken bactin intron)Available SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK12/Cyclin K
Plasmid#231730PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBIG1e-CDK13/Cyclin K
Plasmid#231731PurposeProtein expression in insect cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-7xTRE-3xeGFP
Plasmid#191206PurposeGFP expression under the control of TRE promotorDepositorInsert3X GFP
UseAAVExpressionMammalianPromoterTREAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV HDAC8_374
Plasmid#122174PurposeExpresses a truncated construct of histone deacetylase 8 for crystallography bearing an N-terminal tobacco etch virus protease-cleavable hexahistidine-maltose binding protein tagDepositorInsertHis6 MBP TEV HDAC8_374 (HDAC8 Human)
Tagshexahistidine tag and tobacco etch virus protease…ExpressionBacterialMutationResidues Met1–Pro7 and H375-V377 have been delete…PromoterT7Available SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON)(TRE-SEAP
Plasmid#210513Purposeexpresses PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq-TetON and SEAP reporter in mammalian cellsDepositorInsertssecreted alkaline phosphatase
CMV-PDGFR-TevCs-43LK-iLID(139)-NES-NES-TevN-iLID-TEVseq
TagsMycExpressionMammalianPromoterCMV and TetOAvailable SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
t1-435
Plasmid#166578PurposeFor expression of human talin head (residues 1-435) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1 Head (1-435) (TLN1 Human)
TagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-435 onlyAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSLED.NPL
Plasmid#193014PurposeNeuron-specific reporter (CBh promoter, Pls3 exon, bichromatic reporter)DepositorInsertBichromatic reporter (EGFP and dsRed-Express2)
UseAAVAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Htt171-18Q-myc-WPRE
Plasmid#107936PurposeAdeno-Associated viral (AAV) vector plasmid expressing exon1 of wild type HTT (wtHTT, 18 polyQ repeats) in neuronsDepositorAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-TO/CMV-puro-DD-PAmCherry1-KRas G12D
Plasmid#177320PurposeLentiviral vector expressing PAmCherry1-tagged KRas 4B G12D mutant, with an N-terminal dimerization domain (DD).DepositorInsertKRAS 4B (KRAS Human)
UseLentiviralTagsFKBP-derived dimerization domain (DD, or DmrB) an…ExpressionMammalianMutationG12DPromoterTetOn-CMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLVX--DmrB-DmrB-Ripk3(deltaC)-2A-mCherry-puro
Plasmid#231973PurposeTet inducible expression of DmrB-Ripk3 with mCherry to induce Ripk3 necroptosisDepositorInsertRipk3-deltaC dimerizing construct with bi-cistronic mCherry (Ripk3 Mouse)
UseLentiviralAvailable SinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3Basic_ME.1/ApoEpromoter
Plasmid#51435PurposeThis plasmid is a luciferase-based reporter construct to measure the activity of the ApoE promoter fused to ME.1 enhancerDepositorUseLuciferaseExpressionMammalianMutationME.1 enhancer is fused upstream of ApoE promoter …Available SinceFeb. 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-ePhi29(+exo) (LM2990)
Plasmid#208958PurposeA variant CE1 construct with ePhi29 DNA polymerase (exo active), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-ePhi29(+exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); ePhi29(M8R/V51A/M97T/G197D/E221K/…PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Puro-HEK3 CTT ins
Plasmid#171996PurposeDelivers all prime editing (nickase) components targeting the HEK3 site for a CTT inserrtion, in a single, puromycin selectable plasmidDepositorInsertCbH-Cas9(H840A)-RT-T2A-Puro, hU6-pegRNA HEK3 CTT ins, hU6-sgRNA HEK3 +90
ExpressionMammalianPromoterCMV for Cas9, U6 for gRNAsAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE-Tau-cYFP
Plasmid#92205PurposeRetroviral overexpression vector for α-Syn/Tau bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only