We narrowed to 15,086 results for: NTS;
-
Plasmid#161824PurposeMammalian expression plasmid for RBD of bat coronavirus isolate Rs4231DepositorInsertReceptor-binding domain (RBD) of spike protein S
TagsGSG linker and 8his tag and HA leader sequenceExpressionMammalianMutationHuman codon optimized RBD (a.a. T320-D518)PromoterCMVAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
KHBD00476
Plasmid#39585DepositorAvailable SinceAug. 20, 2012AvailabilityAcademic Institutions and Nonprofits only -
FLS2-YFPn
Plasmid#87165Purposefluorescence complementation assayDepositorAvailable SinceApril 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE3646
Plasmid#137714PurposeExpresses LbCas12a RVRR variant in mammalian cells.DepositorInsertLbCas12a-RVRR
Tags3xHA, NLS, and SV40 NLSExpressionMammalianMutationG532R, K538V, Y542R, K595RPromoterCMVAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3_GCGR-NTEV-TCS-GV-2xHA
Plasmid#194374PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
mH2A2-CT-MYC
Plasmid#45170DepositorAvailable SinceJuly 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 3xFLAG TPP1 88-544 delta166-172
Plasmid#53551Purposemammalian expression of TPP1 full length with 166-172 replaced with "GSSG"DepositorInsertTPP1 (ACD Human)
Tags3xFLAGExpressionMammalianMutationcontains aa 88-544, with aa 166-172 replaced wit…PromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastBac HTB DPP9S S730A
Plasmid#169946PurposePurification of catalytically-dead DPP9S from insect cellsDepositorAvailable SinceMay 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
FusionRed-Dectin1A-C-10
Plasmid#56111PurposeLocalization: Membrane, Excitation: 580, Emission: 608DepositorAvailable SinceApril 1, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3_DRD1-NTEV-TCS-GV-2xHA
Plasmid#194358PurposeSplit TEV assaysDepositorAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 LIC 6A HIS-TEV-DPP8
Plasmid#166793PurposeMammalian cell expression vector for Flag-tagged DPP8DepositorAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV_CaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
Plasmid#163698PurposeAAV vector expressing CaMPARI2_F391W primarily in excitatory neurons in rodent cortexDepositorInsertCaMKII_NES-his-CaMPARI2-F391W-WPRE-SV40
UseAAVTagsFLAG-HA-myc and NES_hisExpressionMammalianPromoterCaMKII fragmentAvailable SinceMarch 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRC/CMV-JAK1P1084A-VSV
Plasmid#139358PurposeExpression of the catalytically impaired JAK1-P1084A mutant (corresponding to TYK2-P1104A)DepositorInsertJAK1 cDNA with 300nt of 5' UTR (JAK1 Human)
TagsVSVExpressionMammalianMutationP1084APromoterCMVAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR AE Clover
Plasmid#90240PurposeLentiviral vector to express JNK KTR AE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (AE mutant)
UseLentiviralTagsmCloverExpressionMammalianPromoterPGKAvailable SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
VRQR-HF1 variant
Plasmid#138563PurposeExpresses human codon-optimized SpCas9-VRQR-HF1 and blasticidin resistance: EFS promoter-VRQR-HF1-NLS-FLAG-P2A-BSDDepositorInsertVRQR-HF1
UseCRISPR and LentiviralTagsBSD, FLAG, and NLSExpressionMammalianMutationN497A, R661A, Q695A, Q926A, D1135V, G1218R, R1335…PromoterEFSAvailable SinceJune 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-E6MBW6
Plasmid#103102PurposeCas9 coding gene template with optimized sequence for human codon usageDepositorInsertE6MBW6(Cas9 coding gene from Staphylococcus lugdunensis M23590)
UseCRISPR; Cloning vectorMutationhuman codon-optimizedAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
BCL9-BirA*
Plasmid#109147PurposeTo generate stable cell lines expressing BCL9-BirA* for BioID proximity labelling through co-transfection with pOG44 in Flp-In T-REx host cellsDepositorAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only