We narrowed to 16,015 results for: grn
-
Plasmid#214445PurposeExpresses eSpCas9 and gRNA targeting Pansio-1 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIA3-Keppel
Plasmid#214446PurposeExpresses eSpCas9 and gRNA targeting Keppel-19 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiCh2-2
Plasmid#202444PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertChromosome 2 gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHB
Plasmid#177981Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHBDepositorInsertsgRNA targeting SDHB (SDHB Human)
UseLentiviralTagsExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgSNRK
Plasmid#138694PurposeExpresses a human SNRK-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV537
Plasmid#177704PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting KU70 homolog in D. hanseniiDepositorInsertsCas9
Nat
tRNA-sgRNA-tRNA
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), TDH3p (Candida lu…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMIA3-Olônne
Plasmid#214447PurposeExpresses eSpCas9 and gRNA targeting Olônne-18 GSHDepositorInserteSpCas9-P2A-mRuby2-P2A-tp53dn
UseCRISPRTagsExpressionMammalianMutationPromoterEF1aAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralTagsExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMonAID_nCas9-PmCDA_Hyg_ALS
Plasmid#91693PurposeMonocot Target-AID vector expressing rice-optimized nCas9-PmCDA1 with sgRNA targeting OsAlsDepositorInsertSpCas9
UseTagsPmCDA1ExpressionPlantMutationD10A for nickase Cas9Promoter2x35SAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDL691
Plasmid#231166PurposeT-DNA encoding TRV2 with ipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESSDepositorInsertipt and mobile gRNAs targeting SlUGT75C1 and SlHAIRLESS
UseTagsExpressionPlantMutationPromoterPEBV sub-genomicAvailable SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PEA1
Plasmid#176527PurposeDelivers all prime editing nickase components in a single plasmidDepositorInsertCbH-Cas9(H840A)-RT, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
UseCRISPRTagsExpressionMammalianMutationPromoterCbH for Cas9, hU6 for gRNAsAvailable SinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-white[coffee]
Plasmid#84006PurposeDonor HR template carrying a 2,080 bp fragment of the Drosophila melanogaster white[coffee] allele and silent mutations conferring resistance to white sgRNAs-1, -2, -3, and -4DepositorInsertA 2,080 bp fragment of the white[coffee] allele (w Fly)
UseUnspecifiedTagsExpressionMutationA GC-to-AA mutation that creates a G589E missense…PromoterAvailable SinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAX198
Plasmid#173042PurposeCustom vector for sgRNA library constructionDepositorInsertHBB Gene - Second and third exons of ENST00000647020.1 (no intron) and part of the 3' UTR (HBB Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermouse U6Available SinceNov. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJW1839
Plasmid#154325PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, R07E5.16 U6 promoter
UseCRISPRTagsExpressionWormMutationF+E mutations in sgRNAPromoterAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2515
Plasmid#91083PurposeModule C, Promoter: AtU6, Gene: Esp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning), Terminator: Pol IIIDepositorInsertEsp3I ccdb cassette for single gRNA spacer cloning (+ BaeI site for GT donor cloning)
UseCRISPRTagsExpressionMutationPromoterAtU6Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGExpressionMutationPromoterAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgBLM10
Plasmid#127643PurposeKnock-out of human BLMDepositorAvailable SinceJuly 9, 2019AvailabilityAcademic Institutions and Nonprofits only