We narrowed to 4,533 results for: Gaa
-
Plasmid#127669PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promotersDepositorInsertCRY2-HA-2A-mCherry and gRNAs 115 and 117
UseCRISPRTagsHAExpressionMammalianPromoterEF1a and hU6Available SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
DYRK4 gRNA (BRDN0001145834)
Plasmid#75519Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKACA gRNA (BRDN0001144986)
Plasmid#75515Purpose3rd generation lentiviral gRNA plasmid targeting human PRKACADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAvA139
Plasmid#248145Purposemutated LuxR transcriptional activator for expression in yeast: fused with Gal4 activation domain with 'gen1' mutationsDepositorInsertluxR (gen1 mutations)
UseIntegration vectorTagsGal4 activation domain and nuclear localization s…ExpressionYeastMutationGal4_AD: N24K, P41 (CCA→CCG), N46D, T92S, V98 (GT…PromoterpPGK1Available SinceJan. 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDG459-HNRNPD-KO
Plasmid#233287PurposeHNRNPD KnockoutDepositorAvailable SinceSept. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hEGFR_2b)-PGKpuro2ABFP-W
Plasmid#208432PurposeLentiviral gRNA plasmid targeting human EGFR gene, co-expression of BFP tagDepositorInsertEGFR (EGFR Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCriprV2-sgRNA-PER1-#2
Plasmid#189988PurposeLentiviral Cas9/sgRNA vector targeting C-terminus of hPER1, works with Addgene 189979-189982DepositorInsertPeriod1 (PER1 Human)
UseCRISPR and LentiviralAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mBltp1 (KIAA1109) - 1
Plasmid#198489Purposelentiviral stable expression of mBltp1 (KIAA1109) gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-GG-hUbC-EBPF2-gRNA-DSP
Plasmid#185549PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting DSPDepositorInsertDSP gRNAs
UseCRISPR and LentiviralExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-2xMS2-mSAT
Plasmid#181908PurposeSingle guide RNA with 2XMS2 loops targeting mouse major satellite repeatsDepositorInsertsgRNA-2XMS2-mSAT
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBSH3- 3m shRNA1
Plasmid#160209PurposeKnock Down MQWSH3- Collybistin isoforms, 3-point mutation negative control for CBSH3- shRNA1 targeting collybistin MQW-CBSH3- isoforms (Plasmid # 160208).DepositorInsertARHGEF9 (Arhgef9 Rat)
UseRNAiMutationGATCGGGAATGCTCaGGcTGtACC (mutations shown in lowe…Promotermouse U6 promoterAvailable SinceOct. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)+gRNA miR-124-1-3'
Plasmid#117324PurposeCRISPR-Cas9 for miR-124-1, 3'DepositorAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TNNI3K gRNA (BRDN0001146965)
Plasmid#77897Purpose3rd generation lentiviral gRNA plasmid targeting human TNNI3KDepositorInsertUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
IRAK2 gRNA (BRDN0001148674)
Plasmid#77731Purpose3rd generation lentiviral gRNA plasmid targeting human IRAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PIK3C2A gRNA (BRDN0001145757)
Plasmid#76416Purpose3rd generation lentiviral gRNA plasmid targeting human PIK3C2ADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RP2 gRNA (BRDN0001148096)
Plasmid#76282Purpose3rd generation lentiviral gRNA plasmid targeting human RP2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1-NME2 gRNA (BRDN0001145211)
Plasmid#75885Purpose3rd generation lentiviral gRNA plasmid targeting human NME1-NME2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NME1 gRNA (BRDN0001146170)
Plasmid#75538Purpose3rd generation lentiviral gRNA plasmid targeting human NME1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pQCXIX_sh_hBcl10_#16
Plasmid#75253Purposeretroviral shRNA vector against human BCL10, expresses GFP for transduction controlDepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EFS-BirAopt-GSQ-RNF4ca-P2A-BLAST
Plasmid#208047PurposeEnables constitutive expression of N-terminal BirAopt-fused RNF4ca (catalytically inactive RING mutant); to perform bioE3; selection with blasticidinDepositorInsertRNF4 (RNF4 Human)
UseLentiviralTagsBirAoptMutationCys>Ala mutations in conserved RING domainPromoterEFSAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-WT-WLS-HA-IRES-GFP
Plasmid#178061PurposeExpression of WLS-HA protein (WT)DepositorAvailable SinceJan. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRIPZ-bioGEF-UBwt-PURO
Plasmid#208045PurposeEnables inducible expression of low-affinity Avitag-Ubwt; to perform bioE3; selection with puromycinDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-SNCA-A53T
Plasmid#181738PurposeTransiently expressing a pegRNA to introduce SNCA-A53T mutation in human cellsDepositorInsertPrime editing pegRNA for SNCA-A53T (SNCA Synthetic)
UseCRISPRExpressionMammalianPromoterHuman U6Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDY1623 NOLC1 sgRNA 2
Plasmid#234834PurposesgRNA 2 for NOLC1 STITCHR insertionDepositorInsertNOLC1 sgRNA (NOLC1 Human)
UseCRISPRAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
CaTCH Dual-sgRNA_sgBC2-A_sgBC2-C
Plasmid#154197PurposeLentiviral expression plasmid encoding two sgRNAs without a target. These can be used as a off-target control for CaTCH barcode cassette BC1. Expresses Thy1.1 and a Neo selection marker.DepositorInsertsgRNA-BC2-A, sgRNA-BC2-C
UseLentiviral; Catch barcode activationExpressionMammalianPromoterhU6 and mU6Available SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP(ABC1D)-2pabPAC(F198Y)
Plasmid#234548Purposeto express a version with reduced constitutive activity (thanks to point mutation F198Y) of the optogenetic tool 2pabPAC, which increases cAMP levels when stimulated by blue light, in astrocytesDepositorInsert2pabPAC(F198Y)
UseAAVMutationF198YPromotermGFAP(ABC1D)Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK3 gRNA (BRDN0001145848)
Plasmid#77166Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only