We narrowed to 15,447 results for: grn
-
Plasmid#176487PurposeTo knockout APP geneDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA sequence
UseCRISPRAvailable sinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
pJY-RpABE-FT_INF
Plasmid#112874Purposebinary vector for INF (Induced Neo-Functionalization) of FT in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting FT
UseCRISPRExpressionPlantAvailable sinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgSetd2#1/Cre
Plasmid#89649PurposeExpresses a Setd2-targeting gRNA and Cre-recombinaseDepositorAvailable sinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_DDX4-cterm
Plasmid#222520PurposeCas9/sgRNA plasmid for targeting DDX4DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCas9, DDX4 sgRNA (DDX4 Human, Synthetic)
UseCRISPRAvailable sinceJan. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PL-CRISPR.EFS.tRFP-gIfngr1-1
Plasmid#166479PurposeExpresses spCas9, tRFP and a gRNA targeting mouse Ifngr1DepositorInsertgRNA for mouse Ifngr1 (Ifngr1 Mouse)
UseLentiviralAvailable sinceApril 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PL-CRISPR.EFS.tRFP-gIfngr1-2
Plasmid#166480PurposeExpresses spCas9, tRFP and a gRNA targeting mouse Ifngr1DepositorInsertgRNA for mouse Ifngr1 (Ifngr1 Mouse)
UseLentiviralAvailable sinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_2
Plasmid#163461Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorAvailable sinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
-
pUDP123
Plasmid#107269PurposepUDP123 expressing a polycistronic g-RNA array for Cas9 editing targeting the genes OpADE2 and OpNIAD and Spcas9D147Y P411T in O. parapolymorpha (HH-gRNAOpADE2-HDV-linker-HH-gRNAOpNIAD-HDV)DepositorInsertpolycistronic HH-gRNA-HDV-HH-gRNA-HDV array targetting OpADE2 and NIAD in O. parapolymorpha
ExpressionYeastPromoterScTDH3Available sinceJune 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2 IRF3 KO
Plasmid#217446PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3DepositorAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_1
Plasmid#86358PurposeEncodes gRNA for 3' target of human CEBPADepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID5B_2
Plasmid#86351PurposeEncodes gRNA for 3' target of human ARID5BDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ARID5B (ARID5B Human)
UseCRISPRAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2 sgSp1
Plasmid#174907PurposeSecond generation sgRNA against Sp1DepositorInsertSpecificity Protein 1 (SP1 Human)
ExpressionMammalianMutationMissense mutation to mutate PAM sequencePromoterEFS-NSAvailable sinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3
Plasmid#98974PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 37bp 3' overhangs. TagBFP.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertLMNA sgRNAs pair 3 and Cas9(D10A)
ExpressionMammalianAvailable sinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgHTT1, sgGFP2, shCas9
ExpressionMammalianPromoterH1, U6, 7SKAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSico-shNKCC1
Plasmid#83027Purposeexpresses an shRNA against NKCC1DepositorInsertshNKCC1
UseCre/Lox, Lentiviral, and RNAiExpressionMammalianPromoterU6Available sinceOct. 25, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJZC101
Plasmid#62335PurposesgRNA (no RNA aptamer addition) with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only