We narrowed to 10,522 results for: UTY
-
Plasmid#176121PurposeConstitutivley active, mitochondrial localized Cdc42DepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only
-
BMR1_03g02090-bio-His
Plasmid#107674PurposeExpresses enzymatically monobiotinylated full-length BMR1_03g02090 ectodomain with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertBMR1_03g02090
TagsratCD4d3+4,biotinylation sequence, 6xHisExpressionMammalianMutationall potential N-linked glycosylation sites (N-X-S…PromoterCMVAvailable SinceOct. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas12f1Cas_ABE-LVA
Plasmid#220995PurposeProkaryotic and constitutive expression of AsCas12f1/TadA8e-LVA fusionDepositorInsertAcidibacillus sulfuroxidans Cas12f1-ABE
UseCRISPRTagsLVAExpressionBacterialMutationD225AAvailable SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOMM20-mTurquoise-RhoA-G14V-deltaCaaX
Plasmid#176123PurposeConstitutively active, mitochondrial localized RhoADepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
TAAR8-DuET
Plasmid#213383PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
TAAR9-DuET
Plasmid#213384PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pREP-8xARE-GFP-SV40-BFP
Plasmid#134910PurposeNRF2 reporter plasmid with GFP under control of 8 ARE elements and constitutively transcribed BFPDepositorInserts8xARE- minimal promoter - GFP
TagBFP
ExpressionMammalianPromoter8xARE - minimal promoter and SV40Available SinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pWPI-N1ICD
Plasmid#185525PurposeConstitutive overexpression of human NOTCH1 intracellular domainDepositorAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Humanized Hinge Notch SNIPR (HNF1A)
Plasmid#188384PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a HNF1A(DBD)-p65(361-551) transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_HNF1A(DBD)-p65(361-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
Tagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
CHRM1-DuET
Plasmid#213207PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCWXPGR-pTF-betaCatenin
Plasmid#114281PurposeTET-inducible expression of a constitutively active form of the BetaCatenin proteinDepositorAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMV-R-GECO1
Plasmid#32444PurposeMammalian expression of Red fluorescent genetically encoded Ca2+ indicator for optical imagingDepositorInsertR-GECO1.0
ExpressionMammalianMutationSubstitutions relative to the mApple-derived anal…PromoterCMVAvailable SinceSept. 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
HA-Foxo1ADA (pCMV5)
Plasmid#12143DepositorInsertFoxo1 ADA (Foxo1 Mouse)
TagsHA and mycExpressionMammalianMutationPhosphorylation-deficient, also referred to as co…PromoterCMVAvailable SinceAug. 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
CMV-ER-LAR-GECO1
Plasmid#61244PurposeExpresses LAR-GECO1 in the endoplasmic reticulum in mammalian cellsDepositorInsertLAR-GECO1
TagsER-retention sequence: KDEL and ER-targeting sequ…ExpressionMammalianMutationSubstitutions relative to R-GECO1: V51W/I113V/N35…PromoterCMVAvailable SinceMarch 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEC3115 (pSpy0K6-P23_mKate2~*ssrA)
Plasmid#218509Purposeintegrative plasmid enabling constitutive expression of mKate2 in Streptococcus pyogenes, integrates into the transcriptionally silent locus Spy_1078 via homologous recombinationDepositorInsertmKate2
TagsssrA degradation tagExpressionBacterialMutationDeletion of Plac_mrfp cassette, introduction of a…PromoterP23Available SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
KL094 - pTRE3G-Flag-Halo-CTCF_WT-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#232930PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible Flag-Halo-mCTCF WT, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycin selection.DepositorInsertFlag-Halo-CTCF WT
UseMouse TargetingExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Hinge Notch SNIPR (HNF1A, ALPPL2 scFv)
Plasmid#188385PurposeLentiviral vector - constitutive expression of an anti-ALPPL2 SNIPR with a CD8alpha-variant2-ECD, a Notch1-TMD, a Notch2-JMD, and a HNF1A(DBD)-p65(361-551) transcriptional factorDepositorInsertPGK_antiALPPL2_CD8alpha-variant2-ECD_Notch1-TMD_Notch2-JMD_HNF1A(DBD)-p65(361-551)
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only