We narrowed to 9,689 results for: Pol
-
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFastBac1-OSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
Plasmid#79030PurposeBaculoviral entry vector to produce Bac-to-bac baculovirusesDepositorInsertOSF-TRIM5alpha(African green monkey pygerythrus)(1-293)
TagsOneSTrEP-FLAGExpressionInsectMutationdeleted amino acid 294-515 from frican green monk…PromoterpolyhedrinAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
EC1000
Bacterial Strain#71852PurposeRepA+ MC1000, KmR , carrying a single copy of the pWV01 repA gene in the glgB gene; host for pOR128-based plasmidsDepositorBacterial ResistanceKanamycinAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPDGFRA-GFP
Plasmid#22919DepositorInserthuman platelet derived growth factor receptor alpha polypeptide promoter driving GFP (PDGFRA Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET15b-His-3C-irisin
Plasmid#122612PurposeExpresses in E. coli: human irisin with Nt histag and 3C protease site for cleavageDepositorInsertirisin (ectodomain of FNDC5) (Fndc5 Bovine, Human, Mouse, Rat)
TagsNt: histag-3C protease siteExpressionBacterialPromoterT7 polymeraseAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVNP2.0-SpCas9
Plasmid#206880PurposeExpresses FLAG-tagged SpCas9 fused to the N-terminus of Gag/GagPol harbouring an intervening phospholipase C-δ1 pleckstrin homology (PH) domainDepositorAvailable SinceOct. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin G13R
Plasmid#60615PurposeEncodes YFP and NLS tagged beta-actin with the G13R depolymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-sfCherry2ΔN12
Plasmid#231551PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated superfolder Cherry2, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagssfCherry2ExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
YFP NLS Beta-Actin S14C
Plasmid#60614PurposeEncodes YFP and NLS tagged beta-actin with the S14C polymerization mutationDepositorAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSSRB070_pAC8-hsCRBN
Plasmid#218789PurposeInsect cell expression vector for FLAG-TEV-Spy-hsCRBNDepositorAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
miABE
Plasmid#205412PurposeVector encoding human codon-optimized enhanced-activity nOgeuIscB fusion with TadA8e driven by CAG promoter, optimized _RNA (_RNA*) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpU6-_RNA*-pCAG-bpNLS-TadA8e(V106W)-32aa-OgeuIscB*(D61A)-GS-bpNLS-GS-TadA8e(V106W)-bpNLS-bGH polyA-pCMV-mCherry-AmpR
ExpressionMammalianMutationD61A+E85R+H369R+S387R+S457RPromoterhU6, CAG, CMVAvailable SinceDec. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M3_3-pTRNA-scf 2.1 (GB2075)
Plasmid#160560PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M3_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM3_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M1_3-pTRNA-scf 2.1 (GB2073)
Plasmid#160558PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M1_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertM1_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVD1 M2_3-pTRNA-scf 2.1 (GB2074)
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable SinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC119-gRNA
Plasmid#52255PurposeCan use a PCR template to assemble new desired guide RNA. Contains an Arabidopsis U6 promoter to drive guide RNA (targeting AtPDS3 gene target site 1) expression with a TTTTTT as terminator.DepositorInsertguide RNA targeting AtPDS3 (PDS3 Mustard Weed)
UseCRISPR; Plant expressionPromoterArabidopsis U6 polymerase III promoterAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-Flag-FANCD2
Plasmid#134904Purposecodon optimized expression and purification of human FANCD2 in insect cells using baculovirusDepositorInsertFANCD2 (FANCD2 Human)
TagsFlagExpressionInsectMutationfully synthetic, codon optimized for insect expre…PromoterpolyhedronAvailable SinceMarch 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKE12-ISceI-fabp10a:loxP-BFP-loxP-Xla.Ctnnb1
Plasmid#198240PurposeFor I-SceI-mediated transgenesis in zebrafish; fabp10a promoter drives expression of activated β-catenin preceded by a blue fluorescent protein (BFP)-STOP cassette flanked by loxP sitesDepositorInsertsUseZebrafish transgenesisAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFAST-BAC BAF155/SMARCC1-His
Plasmid#177863PurposeTransfer vector to generate recombinant baculovirus expressing BAF155/SMARCC1-HisDepositorInsertSMARCC1 (SMARCC1 Human)
TagsHis and His tag at C-terminus with GGGGS linkerExpressionInsectPromoterpolyhedrinAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc Affimer6-msfGFPΔN12
Plasmid#231550PurposeMammalian expression of actin-binding Affimer6 fused to N-terminally truncated monomeric superfolder GFP, for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertAffimer6
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFastbac1-GST-hUSP7
Plasmid#63573PurposeExpression of synthetic human USP7 tagged with GSTDepositorInsertUSP7 (USP7 Human, Synthetic)
TagsGSTExpressionInsectMutationSynthetic based on human protein sequence (please…PromoterPolyhedrinAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only