We narrowed to 15,929 results for: grna
-
Plasmid#196069PurposeExpresses dCas9-Mxi1 with MoRP27 promoter and express gRNA with MoU6 promtoer in M. oryzaeDepositorInsertdCas9-Mxi1
UseCRISPRPromoterMoRP27 promoterAvailable SinceApril 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pIF3
Plasmid#196068PurposeExpresses dCas9-Mxi1 with MoRP27 promoter and express gRNA with MoU3 promtoer in M. oryzaeDepositorInsertdCas9-Mxi1
UseCRISPRPromoterMoRP27 promoterAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJF131B
Plasmid#113326PurposepTet-W108 scRNA.b2, pTet-RR2-sgRNADepositorInsertW108 scRNA_MS2 and sgRNA_RR2
UseCRISPRExpressionBacterialAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN-AND
Plasmid#62308Purposesynthetic circuit: AND gateDepositorInsertsA1NT sgRNA
A4NT sgRNA
A2NT sgRNA
A1NT
UseCRISPRExpressionBacterialPromoterPA2, PPhlF, pA4, and pBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426*-LbSgH
Plasmid#136992PurposeHelper plasmid for LbCpf1 gRNA cloning and expressionDepositorTypeEmpty backboneExpressionYeastPromoterSNR52Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426*-SaSgH
Plasmid#136994PurposeHelper plasmid for SaCas9 gRNA cloning and expressionDepositorTypeEmpty backboneExpressionYeastPromoterSNR52Available SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK372
Plasmid#114687PurposesgRNA targeting NuMA's C-terminal locusDepositorInsertNuMA sgRNA
Available SinceSept. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330_HR_Prnp_3
Plasmid#78621PurposepX330 vector encoding SpCas9 and a chimeric guide RNA targeting Prnp coding sequenceDepositorInsertpX330_HR_Prnp_3
UseCRISPR and Mouse TargetingExpressionMammalianPromoterU6Available SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-HF
Plasmid#133967PurposeExpresses HF-BE3 CRISPR base editor and gRNA scaffold in StreptomycesDepositorArticleInsertHF-BE3
UseCRISPR and Synthetic BiologyAvailable SinceDec. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1819_pCR8-DR-SMN2-2-DR
Plasmid#118653PurposeTransient transfection; Expressed DR-SMN2-DN2-DR CasRx gRNA with preprocessed DR 3'; Gateway DonorDepositorInsertDR-SMN2-2-DR
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Pi21
Plasmid#126892PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ PLDbeta1
Plasmid#126890PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ WRKY28_1
Plasmid#126887PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ HDT701
Plasmid#126886PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac5
Plasmid#126885PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ Rac4
Plasmid#126884PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_2
Plasmid#126895PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only