We narrowed to 13,842 results for: 109
-
Plasmid#133769PurposeExpresses Cas9 and human RhebL1 sgRNADepositorInsertRhebL1 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmcsg7-mCRT(WT)
Plasmid#83505PurposeBacterial expression of CalreticulinDepositorAvailable SinceOct. 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV489
Plasmid#177697PurposePlasmid expressing optimized Cas9 and NAT marker. Compatible with CTG-clade yeast species.DepositorInsertsCas9
Nat
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ) and TDH3p (Candida…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISP_IS
Plasmid#120425PurposeThis plasmid encodes the complete CRISPR/dCas9 machinery for repressing transposition of the following bacterial Insertion Sequences: IS1, IS3 and IS5.DepositorInsertCRISPR spacers targeting IS1, IS5, IS3
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterconstitutiveAvailable SinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSEM387 - mosTI unc-119 - NNN - gfp - nls - tbb-2
Plasmid#182347PurposeGFP transcriptional reporter cloning vector for mosTI(unc-119). Transgene inserted upstream of gfp(2xNLS) and tbb-2 3' UTR. MCS or Golden Gate (BsaI: tgcc - MCS - aaaa)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag 3B/WT myc-M87
Plasmid#87722PurposeExpresses WT myc-M87 spastin isoform in mammalian cellsDepositorInsertSPAST (SPAST Human)
TagsMycExpressionMammalianMutationM87 isoform (deletion of nt 1-490 - 5'UTR an…PromoterCMVAvailable SinceMarch 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
LbCas12a-DR-GC-swap-cr in pBCSK+
Plasmid#126643PurposeCloning vector LbCas12a-DR-GC-swap-crRNA for expression in mammalian cellsDepositorInsertLbCas12a Full Length Direct Repeat GC Swap crRNA
UseCRISPRExpressionMammalianPromoterU6 PromoterAvailable SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pL0_EF-H4
Plasmid#202178PurposeLevel 0 plasmid containing a terminator sequence from gene 34971 from Phaeodactylum tricornutum with EF overhangs used to build a level 1 construct.DepositorInsertH4 terminator
UseSynthetic BiologyMutationNoneAvailable SinceAug. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_EF-fcpA
Plasmid#202164PurposeLevel 0 plasmid containing a terminator sequence from gene 18049 from Phaeodactylum tricornutum with EF overhangs used to build a level 1 construct.DepositorInsertfcpA terminator
UseSynthetic BiologyMutationNoneAvailable SinceAug. 28, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-H4
Plasmid#202122PurposeLevel 0 plasmid containing the promoter from gene 34971 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertH4 promoter
UseSynthetic BiologyMutationNoneAvailable SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL0_AC-P49
Plasmid#202120PurposeLevel 0 plasmid containing the promoter from gene 49202 from Phaeodactylum tricornutum with AC overhangs used to build a level 1 construct.DepositorInsertP49 promoter
UseSynthetic BiologyMutationNoneAvailable SinceAug. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBW300ParsR-Amp32T
Plasmid#78652PurposepSB3K3 carrying araC-PBAD-30hrpV-t-J101-32arsR-t-ParsR-30hrpR-32hrpS-t-hrpL-30gfp-tDepositorInsertaraC-PBAD-30hrpV-t-J101-32arsR-t-ParsR-
UseSynthetic BiologyPromotersee insertAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
isoform PKC Alpha (JCE599)
Plasmid#89779Purposeyeast expression of mouse PKC Alpha with yeast PKC1 promoter and ADH1 terminatorDepositorAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
HB901: pMVP (L3-L2) polyA
Plasmid#121746PurposepMVP L3-L2 entry plasmid, contains human growth hormone polyadenylation signal (polyA) for 3- or 4-component MultiSite Gateway Pro assemblyDepositorInsertPolyadenylation signal (polyA)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-4SA(S61)
Plasmid#33080DepositorInsertYAP (YAP1 Human)
TagsFlagExpressionMammalianMutationS109A, S127A, S164A, S381APromoterCMVAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-P1-N-miRFP670-C
Plasmid#159438PurposeCRISPR knock-in donor construct with fluorescent reporterDepositorInsertmiRFP670
UseCRISPRTags3' linker pair 1, 5' linker pair 1, C t…PromoterCMVAvailable SinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Flag-YAP-4SA(S127)
Plasmid#33082DepositorInsertYAP (YAP1 Human)
TagsFlagExpressionMammalianMutationS61A, S109A, S164A, S381APromoterCMVAvailable SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
IF701: pMVP (L5-L4) APEX2
Plasmid#121725PurposepMVP L5-L4 entry plasmid, contains APEX2 for 4-component MultiSite Gateway Pro assembly. Allows fusion of N-term APEX2 to gene of interest.DepositorInsertAPEX2 (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only