We narrowed to 6,443 results for: plasmid dna
-
Plasmid#212612PurposeFor the expression of a split nLuc that produces luminescence only when circularized. To test your IRES of interest, clone into the EcoRI, BsiWI sites.DepositorInsertTornado-CVB3-split-nLuc
UseLuciferaseTagsExpressionMammalianMutationC373T mutation in CVB3PromoterCMVAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+-mutTornado-split-nLuc
Plasmid#212707PurposeTornado split nLuc with a mutated 3' ribozyme so that circularization cannot occur.DepositorInsertmutTornado-CVB3-split-nLuc
UseTagsExpressionMutationDeleted the partial 3'ribozyme sequence in T…PromoterAvailable sinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CarO-BFP2-TSERex
Plasmid#124795PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertCarO-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Mac-BFP2-TSERex
Plasmid#124793PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertMac-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Tras light chain
Plasmid#216294PurposeExpresses anti-HER2 Tras Light chain in mammalian cells. To be paired with Tras heavy chain to form the anti-HER2 Tras FabDepositorInsertTras light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianMutationPromoterT7 promoterAvailable sinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Pert Light chain
Plasmid#216310PurposeExpresses anti-HER2 Pert Light chain in mammalian cells. To be paired with Pert heavy chain to form the anti-HER2 Pert FabDepositorInsertPert Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianMutationPromoterT7 promoterAvailable sinceAug. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT/TO MycLAP-STIL
Plasmid#80266Purposemammalian expression plasmid for MycLAP-STILDepositorInsertSTIL (STIL Human)
UseTagsMyc-GFPExpressionMammalianMutationPromoterCMVAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Char-BFP2-TSERex
Plasmid#124792PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertChar-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-39S Light chain
Plasmid#216297PurposeExpresses anti-HER2 39S Light chain in mammalian cells. To be paired with 39S heavy chain to form the anti-HER2 39S FabDepositorInsert39S Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianMutationPromoterT7 promoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-MF3958 Light chain
Plasmid#216304PurposeExpresses anti-HER2 MF3958 Light chain in mammalian cells. To be paired with MF3958 heavy chain to form the anti-HER2 MF3958 FabDepositorInsertMF3958 Light chain
UseAffinity Reagent/ AntibodyTagsSignal peptideExpressionMammalianMutationPromoterT7 promoterAvailable sinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-62
Plasmid#208647PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312968-39312987), 62 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.62 (RPL3 Human, Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Human, Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterCMV and U6 in tandemAvailable sinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 - HA-KLF4 FL
Plasmid#34593DepositorInsertKLF4 (KLF4 Human)
UseTagsHA tagExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB3-Fc
Plasmid#200985PurposeMammalian expression plasmid for soluble EphB3 fused to IgG1 FcDepositorInsertEphB3 (EPHB3 Human)
UseTagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB3PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-sPDGFRalpha-Fc
Plasmid#136438PurposeMammalian expression plasmid for soluble ectodomain of PDGFR-alpha fused to IgG1 FcDepositorInsertPDGFRalpha (PDGFRA Human)
UseTagsFc region of IgG1 (a.a. Asp-221 to Lys-447) and L…ExpressionMammalianMutationExtracellular domain of PDGFR-alpha (a.a. 1-524)PromoterCMVAvailable sinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EphB4-Fc
Plasmid#200986PurposeMammalian expression plasmid for soluble EphB4 fused to IgG1 FcDepositorInsertEphB4 (EPHB4 Human)
UseTagsFc region of human IgG1ExpressionMammalianMutationSoluble ectodomain of EphB4PromoterCMVAvailable sinceOct. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CHRFAM7ADelta2bp
Plasmid#62515Purposemammalian expression of human duplicated Alpha7 with 2 bp deletion (CHRFAM7A-∆2bp)DepositorInsertCHRFAM7ADelta2bp (CHRFAM7A Human)
UseTagsExpressionMammalianMutationpartially duplication of CHRNA7 with 2-bp deletio…PromoterCMVAvailable sinceMarch 20, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV Dnajc16-V5
Plasmid#175156PurposeLentiviral expression of mouse Dnajc16-V5DepositorInsertDnajc16 (Dnajc16 Mouse)
UseLentiviralTagsV5ExpressionMammalianMutationPromoterAvailable sinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only