We narrowed to 45,849 results for: eng
-
Plasmid#123111PurposeExpresses 3xFLAG-GABARAP-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPDepositorInsertGamma-aminobutyric acid receptor-associated protein (GABARAP Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-LC3B G120
Plasmid#123094PurposeExpresses 3xFLAG-LC3B G120 in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
Tags3xFLAGExpressionMammalianMutationDeleted amino acids 121-125. Stop codon after G12…PromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.1
Plasmid#91895PurposesgNf1.1 for Nf1 deletionDepositorInsertsgNf1.1
UseLentiviral and Mouse TargetingExpressionMammalianAvailable SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-gp160-754*
Plasmid#123274PurposeMammalian expression plasmid for Env from the BG505 HIV-1 isolate (containing SOSIP mutations); C-terminal truncationDepositorInsertHIV-1 (BG505) Env
TagsCD5 leader peptideExpressionMammalianMutationCodon-optimized synthetic gene; SOSIP mutations; …PromoterCMVAvailable SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pF709-pET28a-Hs-FL-ETFbeta-NHis wt
Plasmid#85110Purposeexpression of recombinant human full-length ETFbeta wt with N-terminal 6xHis-tagDepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV 3xFLAG-LC3B G120A
Plasmid#123093PurposeExpresses 3xFLAG-LC3B G120A in mammalian cells.DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
Tags3xFLAGExpressionMammalianMutationGlycine 120 to AlaninePromoterCMVAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
TV-hPITX3-forward
Plasmid#22073DepositorAvailable SinceOct. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-GFP-U6-gRNA scaffold (SpyCas9)
Plasmid#113039PurposeAAV vector; encodes GFP as well as a U6-driven gRNA scaffold (SpyCas9)DepositorInsert2x BbsI sites - SpCas9 scaffold, co-expressed GFP (transfection marker)
UseAAVExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRSF-Ivy-his-hLYZ
Plasmid#83920PurposeCo-expresses a hisx6 tagged copy of the Ivy protein and the wild type human lysozyme protein, both in the cytoplasmic compartment.DepositorInsertsTagsIvy protein has C-terminal hisx6 tagExpressionBacterialMutationIvy leader sequence deleted and replaced.PromoterT7 and t7Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2.sgNf1.4
Plasmid#92029PurposesgNf1.4 for Nf1 deletionDepositorInsertsgNf1.4 for Nf1 deletion
UseLentiviral and Mouse TargetingExpressionMammalianAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
DRH323: pAAV_hSyn-QuasAr2
Plasmid#107705Purposein vivo voltage imagingDepositorInsertQuasAr2
UseAAVExpressionMammalianAvailable SinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-LC3C-GFP
Plasmid#123110PurposeExpresses 3xFLAG-LC3C-EGFP in mammalian cells, for monitoring ATG4 activity towards LC3CDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3C (MAP1LC3C Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro FLAG wildtype, catalytic active lipin 1
Plasmid#32010DepositorAvailable SinceSept. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTol2-elavl3-Voltron
Plasmid#119037PurposePan neuronal expression of Voltron in zebrafishDepositorInsertVoltron
UseZebrafish expressionPromoterelavl3Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCLc-MND-B2705-KK10-SABR
Plasmid#119053Purpose3rd gen transfer vector. HLA-B2705 linked to b2-microglobulin and CD28-CD3z signaling domain. Contains the HIV(gag) KK10 epitope "KRWIILGLNK" cloned via BsmBIDepositorInsertB2705-KK10-SABR
UseLentiviralExpressionMammalianPromoterMNDAvailable SinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only