We narrowed to 17,131 results for: form
-
Plasmid#55761PurposeAn amino-terminal CFP Fragment was fused to residues 202-477 of RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertRGS7(202-477)-CFP(1-158) (RGS7 Aequorea victoria, Human)
TagsCFP(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationThe RGS sequence amino terminal to the GGL domain…PromoterCMVAvailable SinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTH748-CEN-RLuc/min8maxCFLuc
Plasmid#38214DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first eight codons of the original FLuc gene …PromoterADH1 and TDH3 (=GDP)Available SinceNov. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH753-CEN-RLuc/min346maxCFLuc
Plasmid#38219DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first 346 codons of the original FLuc gene we…PromoterADH1 and TDH3 (=GPD)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTH747-CEN-RLuc/min4maxCFLuc
Plasmid#38213DepositorInsertsFirefly Luciferase
Renilla luciferase
ExpressionYeastMutationThe first four codons of the original FLuc gene w…PromoterADH1 and TDH3 (=GDP)Available SinceOct. 22, 2012AvailabilityAcademic Institutions and Nonprofits only -
PGL4.11-COL1A1WT
Plasmid#230915PurposeExpression of human COL1A1 promoter and testing the promoter activity with luciferase assay.DepositorInsertHuman COL1A1 promoter (COL1A1 Human)
UseLuciferaseTagsluciferase - Luc2pExpressionBacterial and MammalianPromoterCOL1A1Available SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MCM3/5
Plasmid#116950PurposeExpresses human MCM3 and human MCM5DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDF-MCM4/6
Plasmid#116951PurposeExpresses human MCM4 and human MCM6DepositorAvailable SinceNov. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET32-MCM2/7
Plasmid#116949PurposeExpresses human MCM2 and human MCM7DepositorAvailable SinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE
Plasmid#104488PurposeAAV-mediated expression of ultrasensitive protein calcium sensor under the Syn promoterDepositorHas ServiceAAV PHP.eB, AAV Retrograde, AAV1, AAV8, and AAV9InsertjGCaMP7f
UseAAVTagsT7 epitope, Xpress tag, 6xHisExpressionMammalianPromoterSynapsinAvailable SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDuet_huCAD_ICADL (TevS)
Plasmid#100098Purposedual expression of human CAD and ICAD. The two caspase cleavage sites in ICAD were mutated to TEVP cleavable sequencesDepositorExpressionBacterialMutationtwo caspase cleavage sites (DETD-117 and DAVD-224…PromoterT7Available SinceJan. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-mCherry-G12V-KRAS-IRES-Blast
Plasmid#153336PurposeLentiviral vector plasmid for integration and constitutive expression of mCherry fused to oncogenic G12V-KRAS in mammalian cellsDepositorAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha11-RLuc8
Plasmid#140983PurposeEncodes a G alpha subunit (GNA11) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha11-RLuc8 (GNA11 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-Pan-Neurofascin (extracellular) [A12/18R]
Plasmid#177438PurposeMammalian Expression Plasmid of anti-Pan-Neurofascin (extracellular) (Rat). Derived from hybridoma A12/18.DepositorInsertanti-Pan-Neurofascin (extracellular) (Rattus norvegicus) recombinant mouse monoclonal antibody (Nfasc Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlpha12-RLuc8
Plasmid#140985PurposeEncodes a G alpha subunit (GNA12) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlpha12-RLuc8 (GNA12 Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5/FRT/TO-GAlphaz-RLuc8
Plasmid#140978PurposeEncodes a G alpha subunit (GNAZ) containing RLuc8 as an optimal component of a BRET2 biosensor for studying heterotrimeric G protein dissociationDepositorInsertGAlphaz-Rluc8 (GNAZ Human)
UseLuciferaseExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTG1*-thymosinB-8His
Plasmid#111147PurposeExpresses human gamma-actin (codon is optimised for expression in Pichia pastoris) fused with thymosin beta and a His tag.DepositorInsertactin gamma 1 (ACTG1 Human)
UsePichia pastoris integration vectorTagsThymosin beta and a His-tagExpressionYeastMutationcodon-optimised for expression in Pichia pastorisPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA6.2 EmGFP hAQP4(M23)
Plasmid#126464PurposeExpresses human AQP4 (isoform M23) as an EmGFP fusion protein in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only