We narrowed to 14,266 results for: crispr grnas
-
Plasmid#205441PurposeLevel 1 Position 1 pUC19 vector with sgRNA and GmR. Used for homologous recombination with Cas12a editing vector pC1.509. sgRNA targets pC1.509 for removal.DepositorInsertRepB gRNA
UseSynthetic BiologyAvailable SinceMay 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEE390
Plasmid#149280PurposeT-DNA encoding TRV2 with gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE387
Plasmid#149285PurposeT-DNA encoding TRV2 with FT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_FT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE386
Plasmid#149284PurposeT-DNA encoding TRV2 with gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEE388
Plasmid#149286PurposeT-DNA encoding TRV2 with mFT augmented gRNA targeting NbAGDepositorInsertp35S:TRV2_NbAGsgRNA1_mFT:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_045
Plasmid#107144Purposecloning of a sgRNADepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuideFE-Puro
Plasmid#170069PurposeExpresses S. pyogenes CRISPR chimeric RNA element (with F+E modifications) with customizable gRNA from U6 promoter and puromycin resistance from EFS-NS promoterDepositorInsertCas9 guide RNA scaffold with the F+E scaffold modification
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-SpCas9-NG
Plasmid#117919PurposeExpresses 3xFLAG-NLS-SpCas9-NG-NLS in mammalian cells.DepositorInsertSpCas9-NG (L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX330 Pten
Plasmid#59909PurposepX330 backbone expressing sgRNA targeting Pten to edit mouse Pten. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.1
Plasmid#59911PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHEE401
Plasmid#71286PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter), Hyg resistanceDepositorInsertssgRNA scaffold
zCas9
UseCRISPR; Plant binary vectorTags3x FLAG and NLSExpressionPlantMutationZea mays codon-optimized Cas9PromoterEC1.2 promoter and U6-26p Arabidopsis U6 gene pro…Available SinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SpCas9
Plasmid#102851PurposeA single-chain light-controllable dSpCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsp-hGRIN2B-sgRNA; dSpCas9; pdDronpa1 (GRIN2B Human, S. pyogenes, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoterAvailable SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
U6-hGRIN2B-CAG-ps-SaCas9
Plasmid#102853PurposeA single-chain light-controllable dSaCas9 with pdDronpa1 domains for hGRIN2B gene editingDepositorInsertsa-hGRIN2B-sgRNA; dSaCas9; pdDronpa1 (GRIN2B Human, S. aureus, Synthetic)
UseCRISPRTags3X Flag and NLSExpressionMammalianPromoterU6 promoter;Available SinceNov. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYC1640
Plasmid#158719PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using zeocin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYC2085
Plasmid#158721PurposeCRISPR system used for genome editing in Mycobacterium tuberculosis. Helper plasmid expresses Sth1 Cas9 and the cognate sgRNA, using hygromycin as a selection marker.DepositorInsertSth1 sgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-Tetra-com-vector
Plasmid#132553PurposeExpresses spCas9 and sgRNA scaffold with com aptamer replacing the TetraloopDepositorInsertsCas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMLS134
Plasmid#73714PurposeSapTrap destination vector for building sgRNA expression vectors.DepositorInsertpU6::sgRNA
UseCRISPRExpressionWormMutationSapI insertion sitePromoterC. elegans U6 snRNA pol III promoterAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMZ283
Plasmid#52224PurposeExpression of sgRNA precursor with CspCI placeholder for target cloning (see comments).DepositorInsertrrk1-sgRNA
UseCRISPRExpressionYeastPromoterrrk1Available SinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only