We narrowed to 15,447 results for: grn
-
Plasmid#173630PurposeExpresses a Cdkn2a-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Cdkn2a (Cdkn2a Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable sinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-tdTomato90/816
Plasmid#179918PurposeDouble cutting Cas9 plasmid with puromycin resistance and a single guide RNA targeting tdTomato fluorescent protein sites 90 and 816.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserttdTomato sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGG426_UV5
Plasmid#165608PurposeVector for expression of the SpCas9 VRKG variant with sgRNA in E. coli: lacUV5-VRKG(SpCas9, D1135V/S1136R/D1332K/R1333G) and UV5-sgRNA (hEGFP spacer)DepositorInsertlacUV5 driving Streptococcus pyogenes Cas9 VRKG(D1135V/S1136R/D1332K/R1333G) and hEGFP-sgRNA
UseCRISPR and Synthetic BiologyExpressionBacterialMutationD1135V, S1136R, D1332K and R1333G mutations in Sp…PromoterlacUV5 driving Cas9 VRKG and UV5 driving sgRNAAvailable sinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
B-SpCas9
Plasmid#126760PurposeExpression plasmid for human codon-optimized Blackjack-SpCas9 (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with higher fidelity than that of WT SpCas9.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-SpCas9
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationamino acids 1005-1013 replaced with two glycinePromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 1/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75234PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (1/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
NFATc2-CRISPR-Nick 2/2 (PX461-EF1a-pSpCas9n(BB)-2A-GFP)
Plasmid#75235PurposeCRISPR/Cas9 NICKASE plasmid against human NFATc2 (2/2)DepositorInsertsgRNA against NFATc2 (NFATC2 Human)
UseCRISPRAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
RB1-TP53-LRG-GFP
Plasmid#225876PurposeGuides targeting TP53 and RB1DepositorAvailable sinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-IFIH1-ts1
Plasmid#174259PurposeIFIH1 knockdownDepositorAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAPM-miR30-IFIH1-ts2
Plasmid#174260PurposeIFIH1 knockdownDepositorAvailable sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast ACSL3
Plasmid#173165PurposeRetroviral vector to express sgRNA resistant human ACSL3DepositorInsertAcyl-CoA Synthetase Long Chain Family Member 3 (ACSL3 Human)
UseRetroviralMutationSynonymous mutations at sgRNA sitesPromoterMMLVAvailable sinceAug. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1 puro-luc (shRNA)
Plasmid#153962PurposeExpresses a shRNA against firefly luciferaseDepositorInsertshRNA against firefly luciferase (19-bp-long target)
UseLuciferase, RNAi, and RetroviralTagsN/AExpressionMammalianPromoterU6 promoterAvailable sinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg1+sg2+sg3
Plasmid#113969PurposeTriple short guide RNA targeting GTATAGCATACATTATACG, TACCACATTTGTAGAGGTT & CAATGTATCTTATCATGTCDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsg1+sg2+sg3
ExpressionMammalianPromoterU6Available sinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET-FLAG-eSpCas9-plus
Plasmid#126774PurposeExpression of increased fidelity eSpCas9-plus in bacterial cells. Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG, 6xHis, MBP, and NLSExpressionBacterialMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterT7Available sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTFAP2C (TFAP2C Human)
UseCRISPRExpressionMammalianAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZNF423.1.0-gDNA
Plasmid#113790PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF423DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertZNF423 (ZNF423 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
px330-MRPsg2
Plasmid#87190Purposedisruption of human RMRP gene via CRISPR-Cas9, guide 2DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman MRP RNA CRISPR guide #2 (RMRP Human)
UseCRISPRExpressionMammalianPromoterhuman U6Available sinceMarch 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMIR-31-Reporter
Plasmid#71871PurposeMammalian expression vector for the analysis of miR-31 activityDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertReverse complementary sequence of miR-31
Tagsfirefly luciferaseExpressionMammalianPromoterCMVAvailable sinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSUPER-retro-puro-tetO-Mek1-shRNA
Plasmid#53179PurposeExpresses shRNA against mouse Mek1 from puromycin resistance retroviral vectorDepositorAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgIl1r1_#2-hygro
Plasmid#231990PurposeKnockout mouse Il1r1DepositorInsertsgRNA with Cas9 and hygromycin resistance (Il1r1 Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only