We narrowed to 24,091 results for: CRISPR
-
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously rā¦TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable SinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermodified mouse U6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-As
Plasmid#86196PurposeAsCpf1 gRNA entry plasmid using Zea mays Ubi promoter and ribozyme processingDepositorInsertAsCpf1 gRNA cloning site for ribozyme cleavage
UseCRISPRTagsHammerhead ribozyme and HDV ribozymeExpressionPlantPromoterMaize ubiquitin 1Available SinceApril 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGRā)
Plasmid#154840PurposeInsertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.DepositorInserthomology arm:rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGRā
UseCRISPR and Cre/LoxExpressionWormMutationHYGRā encodes aa 1-226Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7501 pHR (hU6-crNT-EFS-PuroR-WPRE)
Plasmid#214876PurposeLentiviral vector encoding RfxCas13d nontargeting control guideDepositorInserthU6-crNT-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-mRFP-; HE1A:BFP -2
Plasmid#180009PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-mRFP; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
SECURE miniABEmax-K20A/R21A (pJUL1774)
Plasmid#131312PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with K20A/R21A mutations).DepositorInsertbpNLS-TadA7.10(K20A/R21A)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
AA364
Plasmid#215956PurposeFragmid fragment: (guide cassette) epegRNA expressionDepositorHas ServiceCloning Grade DNAInsertdU6:3_v1; BsmBI_v14; BsmBI_v15; evopreQ1_v1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRG01-U6-DR-crRNA-BsmbI(x2)-6T; EFS-Puro-2A-Fluc-WPRE
Plasmid#123362PurposeLentiviral vector with empty U6 cassette containing LbCpf1 direct repeat and U6 terminator, with constitutive expression of puromycin resistance and Firefly luciferase.DepositorInsertFirefly luciferase
UseCRISPR, Lentiviral, and LuciferaseExpressionMammalianPromoterEFSAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
1179_pAAV-U6-BbsI-gRNA-CB-EmGFP
Plasmid#89060PurposeAAV-gRNA cloning vector with GFP reporterDepositorInsertEmGFP
UseAAV and CRISPRExpressionMammalianPromoterChicken beta actin with partial CMV enhancerAvailable SinceApril 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC001 - huLshC2C2-MBP for bacterial expression
Plasmid#79150PurposeExpresses human codon-optimized LshC2c2 for purification in E. coliDepositorInsertC2c2
ExpressionBacterialPromoterT7Available SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-FRT
Plasmid#113398Purposeexpresses gRNA for Cas9 FRT targettingDepositorInsertexo, beta, gam, sgRNA-FRT
UseCRISPRExpressionBacterialAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLD037-pCMV-APOBEC-Cas9(D10A)-rXRCC1
Plasmid#165444PurposeExpresses ACX, rXRCC1 in mammalian cellsDepositorInsertAPOBEC-nCas9-rXRCC1 (Apobec1 Synthetic, Rat, Streptococcus pyogenes)
ExpressionMammalianAvailable SinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
6His-MBP-TEV-huLbCpf1
Plasmid#90096PurposeBacterial expression plasmid for protein purificationDepositorInserthuLbCpf1
Tags3xHA, 6xHis, MBP, Nucleoplasmin NLS, and TEV siteā¦ExpressionBacterialAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-ACTB
Plasmid#207748PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of ACTB for knock-in.DepositorAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMVp-dsRed2-Triplex-28-gRNA3-28-gRNA4-28-gRNA5-28-gRNA6-28-pA
Plasmid#55202PurposePlasmid encoding multiplexed 4x gRNAs. This is a modified form of the original plasmid described in the paper (Construct 19). mKate2 was replaced with dsRed2 because of distribution issues.DepositorInsertdsRed2
UseSynthetic BiologyExpressionMammalianPromoterCMVAvailable SinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-LAMP1
Plasmid#227322PurposeDonor template for mStayGold insertion into the C-terminus of the LAMP1 locus. For lysosome visualization. To be co-transfected with sgRNA plasmid px330-LAMP1 (Addgene #207787)DepositorInsertLAMP1 Homology Arms flanking a mStayGold Tag (LAMP1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-mScarlet-LMNB1
Plasmid#207771PurposeDonor template for mScarlet insertion into the N-terminus of the LMNB1 locus for nuclear envelope visualization. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a mScarlet Tag (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits