We narrowed to 4,436 results for: GCA
-
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-Lb
Plasmid#209029PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-intergenic-Lb
Plasmid#209030PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-As
Plasmid#209031PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
DGKA gRNA (BRDN0001144932)
Plasmid#76608Purpose3rd generation lentiviral gRNA plasmid targeting human DGKADepositorInsertDGKA (DGKA Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVTagsExpressionMammalianMutationPromoterHuman U6 and mouse U6Available sinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mCherry-intergenic-As
Plasmid#209037PurposeLentiviral vector expressing mCherry along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic-As
Plasmid#209036PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_3-As
Plasmid#218815PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
DGKE gRNA (BRDN0001147022)
Plasmid#76609Purpose3rd generation lentiviral gRNA plasmid targeting human DGKEDepositorInsertDGKE (DGKE Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-HEK3-CTTins-px330-scaffold
Plasmid#180017PurposeTransiently expressing a pegRNA to introduce HEK3 CTT insertion in human cells. It has a sgRNA scaffold from px330.DepositorInsertPrime editing pegRNA for HEK3-CTTins, with px330 scaffold (EPHA8 Synthetic)
UseCRISPRTagsExpressionMammalianMutationPromoterHuman U6Available sinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 AD
Plasmid#188130PurposeExpresses C-terminal flag-tagged human CAD hCPS1 AD in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…PromoterAvailable sinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLED.CaRPv1
Plasmid#193018PurposeExcitatory/Inhibitory neuron calcium indicator (hSyn promoter, Synrg exon, jRGECO1a/jGCaMP7b)DepositorInsertBichromatic calcium indicator (jGCaMP7b and jRGECO1a)
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
Ai162 (TIT2L-GC6s-ICL-tTA2) targeting vector
Plasmid#114433PurposeTarget a Cre-dependent GCaMP6s cassette and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6s, tTA2
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Ai148 (TIT2L-GC6f-ICL-tTA2) targeting vector
Plasmid#114428PurposeTarget a Cre-dependent GCaMP6f expression and a tTA2 cassette into the mouse TIGRE locusDepositorInsertGCaMP6f
UseCre/Lox and Mouse TargetingTagsExpressionMutationPromoterTRE2, CAGAvailable sinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasWT/sgKras/Cre
Plasmid#99848PurposeExpresses Cre-recombinase, a barcoded HDR template that serves as a control for HDR into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxTagsExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…PromoterAvailable sinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2ExpressionMutationPromoterAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only