We narrowed to 14,471 results for: cas9 genes
-
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX458-MAFB-sg
Plasmid#194720Purposepx458 with guide RNA that target hMAFBDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTJV1ScGm-rpoB
Plasmid#166979PurposeGenerates ssDNA in vivo targeting E. coli rpoB for recombineering w/ Beta recombinase; temp. sensitive pSC101 ori and sgRNA for Cas9 counterselection; aacC1 for gentamycin resistanceDepositorInsertgentamycin-3-acetyltransferase (aac(3)-Ia )
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-CRISPR-Puro-sgRPL3-56
Plasmid#208979PurposepcDNA3.1 based plasmid for transient transfection of sgRNA-cas9. Containing sgRNA targeting human RPL3 (GRCh38.p14_Chr22:39312868-39312887), 56 is a number given by www.e-crisp.org.DepositorInsertsgRNA targeting human RPL3 (ENST00000216146) C-terminal, No.56 (RPL3 Synthetic, Human)
UseCRISPRExpressionMammalianPromoterCMV and U6 in tandemAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459-CDKN1A
Plasmid#217457PurposeFor CDKN1A (p21) knockoutDepositorInsertCRISPR Cas9 guide for CDKN1A
UseCRISPRExpressionMammalianAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMJ824
Plasmid#39314DepositorInsertCas9
UseCRISPRTagsGST and His6ExpressionBacterialPromoterT7Available SinceSept. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
GESTALT_pX330-v1
Plasmid#103061Purposeplasmid px330 with guide targeting GESTALT v1 through V5 constructsDepositorInsertintegration of Cas9 with guide targeting GESTALT barcodes V1 to V5
UseLentiviralAvailable SinceNov. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_RAD21_1
Plasmid#64057PurposeExpresses gRNA against human RAD21 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJJB1577
Plasmid#218619PurposeExpress Pex5, Pex2, Pex17, and Pex10DepositorInsertPex5
ExpressionYeastAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458_CREB1_1
Plasmid#64939PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
VKG1-gRNA-pX330
Plasmid#108671PurposeCleavage of VKG1 sequence by CRISPR/Cas9DepositorInsertgRNA for VKG1 sequence
UseCRISPRAvailable SinceMay 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCZGY2727
Plasmid#193330PurposeSite specific insertion using CRISPR/Cas9 editing of C. elegans ChrIDepositorInsertHygromycin resistance
ExpressionWormPromoterPrps-0Available SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_1
Plasmid#64036PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPB_2
Plasmid#64047PurposeExpresses gRNA against human CEBPB along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRPromoterU6Available SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTopo pLox hPGK-Puro pA pLox
Plasmid#171048PurposeEmpty donor template for CRISPR/Cas9 targeting of TERT RE'sDepositorTypeEmpty backboneUseCre/LoxExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_CREB1_2
Plasmid#64940PurposeExpresses gRNA against human CREB1 along with Cas9 with 2A GFPDepositorInsertgRNA
UseCRISPRAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only