We narrowed to 13,472 results for: sequence

#87408

p426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#86007

lenti reporter plasmid with Z-AAT-specific gRNA target-sequence, to be used with tGFP #26864

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#86009

lenti reporter plasmid with TTR_V30M-specific gRNA target-sequence, to be used with tGFP #26864

Tobias Cantz

Eggenschwiler et al Sci Rep. 2016 Dec 2;6:38198. doi: 10.103

Feb. 1, 2017

Academic Institutions and Nonprofits only

#74430

Calb2 UTR with mutated AU binding sequence and mir-30 site 1 and 2

Emanuela Felley-Bosco, Rolf Stahel

Kresoja-Rakic et al Front Genet. 2017 May 29;8:70. doi: 10.3

April 21, 2016

Academic Institutions and Nonprofits only

#72003

Expresses the N-terminal extracellular region of the PlexinB2 protein following proteolytic cleavage (ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 25, 2016

Academic Institutions and Nonprofits only

#72082

Expresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 12, 2016

Academic Institutions and Nonprofits only

#72080

Expresses the extracellular region of the JAM-3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 12, 2016

Academic Institutions and Nonprofits only

#71958

Expresses the extracellular region of the LRRC4 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 2, 2016

Academic Institutions and Nonprofits only

#71954

Expresses the extracellular region of the JAM-3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 2, 2016

Academic Institutions and Nonprofits only

#71955

Expresses the extracellular region of the JAM-4, isoform 1 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Feb. 1, 2016

Academic Institutions and Nonprofits only

#71956

Expresses the extracellular region of the JAM-4, isoform 3 protein, C-terminally fused to alkaline phosphatase + 6X histidine tag.

Woj Wojtowicz

Visser et al Elife. 2015 Dec 3;4. pii: e08149. doi: 1

Jan. 26, 2016

Academic Institutions and Nonprofits only

#98398

Lentivirus for expression of non-targeting control shRNA (Dox-inducible)

Roland Friedel

Junqueira Alves et al Nat Commun. 2021 Oct 14;12(1):6019. doi:

July 12, 2017

Academic Institutions and Nonprofits only

#131913

Gateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors

RESOLUTE Consortium, Giulio Superti-Furga

Superti-Furga et al Nat Rev Drug Discov. 2020 Jul;19(7):429-

Oct. 11, 2019

Industry, Academic Institutions, and Nonprofits

#131903

Gateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors

RESOLUTE Consortium, Giulio Superti-Furga

Superti-Furga et al Nat Rev Drug Discov. 2020 Jul;19(7):429-

Oct. 11, 2019

Industry, Academic Institutions, and Nonprofits

#132115

Gateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors

RESOLUTE Consortium, Giulio Superti-Furga

Superti-Furga et al Nat Rev Drug Discov. 2020 Jul;19(7):429-

Dec. 4, 2019

Industry, Academic Institutions, and Nonprofits

#131953

Gateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectors

RESOLUTE Consortium, Giulio Superti-Furga

Superti-Furga et al Nat Rev Drug Discov. 2020 Jul;19(7):429-

Oct. 21, 2019

Industry, Academic Institutions, and Nonprofits