We narrowed to 15,152 results for: GRN
-
Plasmid#75572Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PBK gRNA (BRDN0001147308)
Plasmid#75574Purpose3rd generation lentiviral gRNA plasmid targeting human PBKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DYRK3 gRNA (BRDN0001145918)
Plasmid#75547Purpose3rd generation lentiviral gRNA plasmid targeting human DYRK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
INSR gRNA (BRDN0001145804)
Plasmid#75506Purpose3rd generation lentiviral gRNA plasmid targeting human INSRDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK1 gRNA (BRDN0001147568)
Plasmid#75522Purpose3rd generation lentiviral gRNA plasmid targeting human VRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
VRK1 gRNA (BRDN0001148483)
Plasmid#75523Purpose3rd generation lentiviral gRNA plasmid targeting human VRK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PDGFRA gRNA (BRDN0001148373)
Plasmid#75493Purpose3rd generation lentiviral gRNA plasmid targeting human PDGFRADepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA1 gRNA (BRDN0001148481)
Plasmid#75499Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
BCKDK gRNA (BRDN0001147783)
Plasmid#75503Purpose3rd generation lentiviral gRNA plasmid targeting human BCKDKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPS6KA5 gRNA (BRDN0001146427)
Plasmid#77373Purpose3rd generation lentiviral gRNA plasmid targeting human RPS6KA5DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
ALDH18A1 gRNA (BRDN0001487061)
Plasmid#77996Purpose3rd generation lentiviral gRNA plasmid targeting human ALDH18A1DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAPK8 gRNA (BRDN0001487083)
Plasmid#78047Purpose3rd generation lentiviral gRNA plasmid targeting human MAPK8DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
FYN gRNA (BRDN0001145913)
Plasmid#77245Purpose3rd generation lentiviral gRNA plasmid targeting human FYNDepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKMYT1 gRNA (BRDN0001146095)
Plasmid#77278Purpose3rd generation lentiviral gRNA plasmid targeting human PKMYT1DepositorAvailable SinceJune 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001148477)
Plasmid#76911Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
PRKAA2 gRNA (BRDN0001146900)
Plasmid#76635Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA2DepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GSK3A gRNA (BRDN0001148594)
Plasmid#76370Purpose3rd generation lentiviral gRNA plasmid targeting human GSK3ADepositorAvailable SinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GNE gRNA (BRDN0001145858)
Plasmid#77830Purpose3rd generation lentiviral gRNA plasmid targeting human GNEDepositorAvailable SinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 9 gRNA
Plasmid#68352Purposepx330 with gRNA towards SMAD exon 9. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 9 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
px330_SMAD exon 2 gRNA
Plasmid#68350Purposepx330 with gRNA towards SMAD exon 2. Cas9 is expressed from a CAG promoter.DepositorInsertSMAD exon 2 gRNA
ExpressionMammalianPromoterU6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
NLS-R-NmeCas9 (D16A)-HA-NLS_sgRNA EZH guide
Plasmid#246438PurposeAll-in-one plasmid. Expresses R-NmeCas9 in mammalian cells for RNA knockdown. Spacer targeting EZH2 gene.DepositorInsertsNmeCas9
Nme-sgRNA
TagsHA tag, NLS, and SV40 NLSExpressionMammalianMutationchanged Aspartic acid 16 to Alanine, deleted amin…PromoterEF-1 alpha and U6Available SinceOct. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA-S1b (BsaI)-CBh-eCas12f1i
Plasmid#233080PurposeExpression vector for sgRNA-S1b and eCas12f1iDepositorInsertU6-sgRNA-S1b (BsaI)-Cbh-bpNLS-eCas12f1i-2xFLAG-P2A-EGFP
UseCRISPRTags2xFLAGExpressionMammalianPromoterhU6, CBhAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-Fermt2 sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179117PurposeExpresses Fermt2 sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertFermt2 sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pM124: pAAV-EFS-CasRx-VEGFA presgRNA
Plasmid#166872PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA for RNA-editingDepositorInsertsU6-VEGFA presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag VP64 gRNA4 (FWA)
Plasmid#120249PurposeCRISPR-Cas9 SunTag system to target VP64 to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXJ218-pAAV-PB3'IR-U6-gRNA-directcapture-EF1a-mtagBFP2-KASH-PB5'IR
Plasmid#213480PurposeAAV piggybac transposon vector, with mtagBFP-KASH reporter and gRNA cloning site. Compatible with 10X 3' and 5' gRNA capture technology.DepositorInsertsmtagBFP-KASH
U6-gRNA-directcapture
UseAAVExpressionMammalianAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Splicing-targeting CRISPR-Cas9 library for human lncRNAs
Pooled Library#119977PurposeDesigned for genomic deletion screening of functional lncRNAs by targeting their splice sites.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB_rtTA_BsmB-XRN2_sgRNA_1
Plasmid#242895PurposePiggyBac cargo vector with XRN2 sgRNA 1 for dox-inducible knockdownDepositorAvailable SinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA13-3
Plasmid#248540PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA13-3
UseCRISPRExpressionMammalianPromoterU6Available SinceDec. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA13-5
Plasmid#248541PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA13-5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA7-1
Plasmid#248530PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA7-3
Plasmid#248531PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA7-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-gRNA10-3
Plasmid#248536PurposeA CRISPR-based technology to study chromosome-specific aneuploidy by targeting human centromeresDepositorInsertgRNA10-3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX330-sgRNA006_CTCF
Plasmid#232928PurposeExpression vector for a sgRNA against the mouse CTCF locus and SpCas9.DepositorAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
PX459-sgRNA048_Grb10
Plasmid#232934PurposeExpression vector for a sgRNA against the mouse Grb10 locus and SpCas9 with T2A-Puromycin resistance gene.DepositorInsertCas9-T2A-PuroR (Grb10 S. pyogenes)
ExpressionMammalianAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
EHMT1_exon 3_gRNA
Plasmid#228809PurposeCRISPR targeting of human EHMT1DepositorAvailable SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-gRNA
Plasmid#226867PurposeLentiviral expression of Sp-gRNA with BlpI and BstXI restriction sites for gRNA spacer cloning. Also expresses BFP.DepositorInsertLenti Sp-gRNA
UseLentiviralPromotermU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
LC3B sgRNA
Plasmid#207556PurposepX330 expressing Cas9 and a sgRNA targeting the LC3B locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-R-gfp
Plasmid#220927PurposeExpresses gfp using J23119 promoter and pgRNA_AT backboneDepositorInsertsuperfolder GFP
TagsFLAGExpressionBacterialPromoterJ23119Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 KO sgRNA
Plasmid#207103PurposepX330 based plasmid for expression of Cas9 and the GGTGTAACGTGGAGCCAGTA sgRNA to target the MDC1 coding sequence.DepositorInsertGGTGTAACGTGGAGCCAGTA
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNAs-Crym
Plasmid#200067PurposeFor the knock down of Crym with an astrocyte specific mCherry expressionDepositorInsertU6-3xsgRNA-Crym
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG9A sgRNA
Plasmid#207557PurposepX330 expressing Cas9 and a sgRNA targeting the ATG9A locusDepositorInsertCACTGAATACCAGCGCCTAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
WIPI2 sgRNA
Plasmid#207554PurposepX330 expressing Cas9 and a sgRNA targeting the WIPI2 locusDepositorInsertCGCGCGCCCAGCCATGAACC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6_ ATM_G101_sgRNA_CAG_St1Cas9_CNRZ1066_v2
Plasmid#214814PurposeA single vector containing a CAG-driven Cas9 variant from S. thermophilus recognizing a consensus NNACAA PAM (St1Cas9 CNRZ1066 v2) and its U6-driven sgRNA targeting human ATMDepositorAvailable SinceFeb. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TKT_sgRNA2
Plasmid#201625PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTKT (TKT Human)
UseCRISPR and LentiviralAvailable SinceJuly 26, 2023AvailabilityAcademic Institutions and Nonprofits only