We narrowed to 15,840 results for: GRN
-
Plasmid#109011PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pCB30
Plasmid#111910PurposeExpresses gRNA to target URA3 knockout locus and has KanMX markerDepositorInsertgRNA cassette targeting URA3 knockout locus
UseCRISPRExpressionBacterial and YeastPromoterSNR52pAvailable SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_GABPB1_iso2_1
Plasmid#104041PurposeEncodes gRNA for 3' target of human GABPB1_iso2 along with Cas9 with 2A GFPDepositorAvailable SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRSETb MGlucoMeter2.6-1m
Plasmid#247471PurposeMatryoshka-based Glucose SensorDepositorInsertGlucose Binding Protein (GBP) with Matryoshka dual fluorophore cassette
ExpressionBacterialAvailable SinceFeb. 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-Dn29-dCas9-P2A-GFP
Plasmid#247155PurposeMammalian expression of a human codon optimized wildtype Dn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(SapI)-EFS-CasRx-T2A-mCherry-pA
Plasmid#192481PurposeTo express CasRX and a gRNADepositorInsertCasRx
UseAAVMutationNoPromoterU6/EFSAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKM-U6-reRNA-hsHEKsite_1_3
Plasmid#205638PurposereRNA guide targeting HEKsite_1_3DepositorAvailable SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
p8389 LentiCRISPRv2 Neo sgNT-1
Plasmid#221649PurposeExpression of non-targeting control sgRNADepositorInsertnon-targeting sgNT-1
UseCRISPR and LentiviralAvailable SinceSept. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-sgCTG-CAG-Cas9D10A nickase-Blast
Plasmid#216733PurposeExpresses SpCas9-D10A nickase under a CAG promoter together with a blasticidin resistance gene, along with a U6 promoter driving the sgCTG (target sequence: (CUG)6). Suitable for lentivirus packaging.DepositorArticleInsertCas9-D10A nickase and sgCTG
UseCRISPR and LentiviralExpressionMammalianMutationD10APromoterU6 and CAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRnc-gGFP161
Plasmid#189536PurposeExpresses E. Coli RNase III under control of pBAD promoter and constitutively expresses gUTR-161-GFPDepositorInsertsRNase III
gUTR-161-GFP
ExpressionBacterialMutationN/APromoterJ23119 and pBADAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
ZMYND8-2A-neo
Plasmid#190619PurposeLentiviral expression plasmid of human ZMYND8, neomycin selectionDepositorInsertZMYND8 (ZMYND8 Human)
UseLentiviralTags3xFlagExpressionMammalianMutationsynonymous mutation for sgRNA resistance at aa214…Available SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 mCherry-hCortKD-Flcortmut3YD
Plasmid#187266PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YD mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YD (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0 hCortKD-Flcortmut3YF mCherry
Plasmid#187265PurposeLentiviral expression of shRNA targeting Cortactin + reconstitution of Cortactin3YF mutantDepositorInsertCortactin (CTTN Human)
UseLentiviralTagsmCherryMutation3YF (Y412, Y470, Y486)PromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0582 huDisCas7-11 R1045-GGGS-R1122 U6-NT guide
Plasmid#186991PurposeAAV transgene plasmid for Cas7-11-R1045-GGGS-R1122, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-r1045-gggs-r1122, non-targeting crRNA guide
UseAAVMutationr1045-gggs-r1122 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiguide-puro_hORAI1sg
Plasmid#174326PurposegRNA targeting hORAI1 - encodes puromycin resistanceDepositorInserthuman Orai1 (ORAI1 Human)
UseLentiviralAvailable SinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pegAAT K342E correction
Plasmid#169841PurposeExpress a pegRNA used for correction (via A•T-to-G•C) of the E342K mutationDepositorInsertpegAAT K342E correction (SERPINA1 Human)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO.puro_shHuR 3UTR
Plasmid#110412PurposeTRCN0000276186 (Target TTGTTAGTGTACAACTCATTT), silence human ELAVL1 (HuR) gene, doxycycline inducible, puromycin selectionDepositorInsertELAVL1 (HuR)
UseLentiviral and RNAiExpressionMammalianPromoterH1/TO (RNA PolIII)Available SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EF1a-CD90.2-Rluc_miR
Plasmid#163360PurposeLentiviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase, with expression of a CD90.2 surface marker.DepositorAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hTRAC
Plasmid#154094PurposeSelf-Cutting and Integrating CRISPR backbone targeting human TCR-alpha common chainDepositorInsertsgRNA and BAIT targeting human TRAC locus
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only