We narrowed to 16,664 results for: grn
-
Plasmid#198487Purposelentiviral stable expression of mCert1 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only
-
Lenti-guide-puro mPHB2-1
Plasmid#198483Purposelentiviral stable expression of mPHB2 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mHgs-2
Plasmid#198482Purposelentiviral stable expression of mHgs gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mCct8 - 1
Plasmid#198503Purposelentiviral stable expression of mCct8 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Nlgn3 KI
Plasmid#131501PurposeEndogenous tagging of Neuroligin-3: N-terminal (amino acid position: T37)DepositorUseCRISPRExpressionMammalianPromoterU6 and CbhAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE N-terminal
Plasmid#137182PurposeAAV genome: expresses the N-terminal of S. aureus v5 AAV-CBE from the Cbh promoter, U6-sgRNADepositorInsertv5 AAV-saCBE N-terminal
UseAAVMutationCas9 D10APromoterCbhAvailable SinceFeb. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
sgGFP_3
Plasmid#78165PurposesgGFPDepositorInsertGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cbh_v5 AAV-saCBE_KKH C-terminal
Plasmid#137184PurposeAAV genome: expresses the C-terminal of S. aureus v5 AAV-CBE, and U6-sgRNA (KKH variant).DepositorInsertv5 AAV-saCBE_KKH C-terminal
UseAAVMutationE782K;N968K;R1015H conferring recognition of NNNR…PromoterCbhAvailable SinceJan. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAT100
Plasmid#180512PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFUGW ORANGE Tubb3-GFP KI _ mCherry-KASH
Plasmid#131508PurposeEndogenous tagging of β3 Tubulin: C-terminal (amino acid position: STOP codon)DepositorUseLentiviralExpressionMammalianPromoterhUBCAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-CADPS KI
Plasmid#131482PurposeEndogenous tagging of CAPS1: N-terminal (amino acid position: S39)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgTh(2)
Plasmid#209198PurposeMutagenesis of ThDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpG-PPE
Plasmid#170130PurposeFor plant prime editing in wheat plants or monocotyledons protoplastsDepositorInsertnCas9-SpG(H840A)-M-MLV
UseCRISPRExpressionPlantMutationH840A, D1135L, S1136W, G1218K, E1219Q, R1335Q, T1…Promotermaize Ubiquitin-1Available SinceMay 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAT527
Plasmid#180514PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, mNeonGreen, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pegCTNNB1 S45del
Plasmid#169844PurposepegRNA used for installation (via TCC deletion) of the oncogenic S45del in Ctnnb1 in mouse liver.DepositorInsertpegCTNNB1 S45DEL (Ctnnb1 Mouse)
ExpressionMammalianAvailable SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
Plasmid#78607PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23DepositorInsertEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterEF1a-short; U6Available SinceSept. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Clta KI
Plasmid#131483PurposeEndogenous tagging of Clathrin light chain α: N-terminal (amino acid position: M1)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2-sgACSL4 clone2
Plasmid#162129PurposeLentiviral sgRNA plasmid targeting human ACSL4DepositorInsertsgACSL4 (ACSL4 Human)
UseLentiviralAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only