We narrowed to 11,695 results for: nar
-
Plasmid#136473PurposeSSB-mTur2 IDL fusion expression plasmidDepositorInsertSSB-mTur2 (ssb E. coli)
TagsmTurquoise2ExpressionBacterialMutationmTurquoise2 inserted between Phe148 and Ser149PromoterT7 promoterAvailable SinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PVT1-luciferase
Plasmid#113350Purposeevaluate FOXA1 DIV motif enhancer activity near 50 kb of PVT1 geneDepositorInsertPVT1-enhancer (PVT1 Human)
UseLuciferaseAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTE2690
Plasmid#137717PurposeExpresses dimpLbCas12a-SunTag in mammalian cells.DepositorInsertdimpLbCas12a
UseCRISPRTagsNLSx3 SV40 and SunTagx10ExpressionMammalianMutationD156R, G532R, K538V, Y542R, K595R, D832A,PromoterCMVAvailable SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-mEmerald Rab7a
Plasmid#115238PurposeTo express in mammalian cells the endocytic protein Rab7a fused to mEmerald by transfection or by generating AAV virions.DepositorInsertRab7a fused to mEmerald (RAB7A Human)
UseAAVTagsmEmeraldExpressionMammalianMutation7 Amino Acids (21 Nucleotides) between mEmerald a…PromoterHuman UbCAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
LD101: pMVP (L3-L2) eCFP + WPRE
Plasmid#121775PurposepMVP L3-L2 entry plasmid, contains eCFP + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eCFP fusion to gene of interest in lentivirus vectors.DepositorInserteCFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
DEL-pHG165a
Plasmid#90064PurposeLLhG coding region on pHG165a interrupted with a single base-pair deletion, 'no repressor' control plasmidDepositorInsertDEL
ExpressionBacterialPromoterIqAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJ4M_hnRNPA2_FL_D290V
Plasmid#139110PurposeExpress FL hnRNPA2 D290V with a C-terminal MBP tagDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAT-9218
Plasmid#124225PurposeBacterial SpCas9 expressionDepositorInsertSpCas9
UseCRISPRExpressionBacterialPromoterTetR/TetAAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
LLP784_SnoopCatcher-DNMT3A-CO
Plasmid#211777PurposeSnoopTag counterpart binding domain, SnoopCatcher, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertSpy-EZH2
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect EZH2 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
LLP780_SpyCatcher-KRAB-CO
Plasmid#211773PurposeSpyTag counterpart binding domain, SpyCatcher, fused to transcriptional repressor KRAB, with GFP selectionDepositorInsertSpyCatcher-KRAB
Tags3xFLAGExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect KRAB e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-PU.1-ETS
Plasmid#124652PurposeChimeric ETS domainDepositorAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pIRESneo-Ago2
Plasmid#215841PurposeExpression of AGO2DepositorInsertHuman AGO2 (AGO2 Human)
ExpressionMammalianAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
MP6.6TAG_AraC_Para-dnaQ926-dam-seqA-emrR-ugi-CDA1.6TAG
Plasmid#163719PurposeArabinose-inducible expression of six mutagenesis genes, each encoding one amber codon after the initiator methionineDepositorInsertaraC dnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TAG CDA1.1TAG
ExpressionBacterialMutationdnaQ926.1TAG dam.1TAG seqA.1TAG emrR.1TAG ugi.1TA…Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMA7
Plasmid#79967PurposeTM-MAGE strainDepositorInsertsLambda Red recombinase beta subunit
DNA adenine methylase
UseSynthetic BiologyExpressionBacterialPromoterpBADAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHY98-LMNA 5'HA-TriTag (mTagBFP)-3'HA (HDR donor)
Plasmid#164046PurposeCRISPR donor plasmid to insert TriTag (mTagBFP) into the N-terminus of human LMNA geneDepositorInsertmTagBFG-TriTag
UseCRISPRExpressionMammalianAvailable SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsXRN1-del1174-1649_AH
Plasmid#148904PurposeMammalian Expression of HsXRN1-del1174-1649DepositorInsertHsXRN1-del1174-1649 (XRN1 Human)
ExpressionMammalianAvailable SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP779_αGCN4-VP64-CO
Plasmid#211772PurposeSunTag counterpart binding domain, αGCN4, fused to transcriptional activator VP64, with GFP selectionDepositorInsertaGCN4-VP64
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon-optimised (CO) to detect VP64 e…PromoterpEF1a and pSV40Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP789_αGCN4-DNMT3A-CO
Plasmid#211783PurposeSunTag counterpart binding domain, aGCN4, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-GFP-mSox2
Plasmid#206374PurposeExpresses EGFP fused mouse SOX2 in mammalian cells, for lentivirus generation.DepositorAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 integrase (GB1496)
Plasmid#160578PurposeStreptomyces phage PhiC31 integrase, complete CDSDepositorInsertPhiC31
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1.sensor
Plasmid#162844PurposeYeast expression of the RNA-based sensor for fructose-1,6-bisphosphate #4_1DepositorInsert4_1_RNA-device
ExpressionYeastAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFBP-4_1m.mutant
Plasmid#162869PurposeYeast expression of the mutant #4_1m for the RNA-based sensor of fructose-1,6-bisphosphate #4_1DepositorInsert4_1m_RNA-device
ExpressionYeastAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
LC501: pMVP (L3-L2) mCherry + polyA
Plasmid#121765PurposepMVP L3-L2 entry plasmid, contains mCherry + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term mCherry fusion to gene of interest.DepositorInsertmCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT-9208
Plasmid#124221PurposeCloning plasmid for a self-targeting gRNA libraryDepositorInsertself-targeting gRNA
UseCRISPRExpressionBacterialPromoterJ23119Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGB3 alpha1 Pnos:PhiC31int:Tnos (GB1531)
Plasmid#160616PurposeTU for the constitutive expression of Streptomyces phage PhiC31 integrase.DepositorInsertPhiC31
UseSynthetic BiologyExpressionPlantMutationBsaI and BsmBI sites removedPromoterPnosAvailable SinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HSF1 KO
Plasmid#200207PurposegRNA for HSF1 KODepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
KP301: pMVP (L5-L4) mCherry-P2A
Plasmid#121710PurposepMVP L5-L4 entry plasmid, contains mCherry-P2A for 4-component MultiSite Gateway Pro assembly. Allows expression of N-term mCherry linked by P2A to gene of interest.DepositorInsertmCherry-P2A (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsDCP2-F404AF407AF409A_V
Plasmid#147813PurposeMammalian Expression of HsDCP2-F404AF407AF409ADepositorInsertHsDCP2-F404AF407AF409A (DCP2 Human)
ExpressionMammalianMutationtwo silent mutations compared to the sequence giv…Available SinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
KZ001: pMVP (L3-L2) P2A-eYFP + polyA
Plasmid#121770PurposepMVP L3-L2 entry plasmid, contains eYFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eYFP linked by P2A to gene of interest.DepositorInsertP2A-eYFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1‐Afu‐rnhBΔPIP
Plasmid#108696PurposeFor expression in E. coli, and affinity purification of N-terminally GST-tagged Archaeoglobus fulgidus RNase HII with C-terminal PIP box deletionDepositorInsertrnhB
TagsGSTExpressionBacterialMutationC-terminal truncation (7aa) removing PIP boxPromotertacAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
LacI/109-pHG165c
Plasmid#90058PurposeWT LacI polymorphism with T at position 109DepositorInsertLacI/109
ExpressionBacterialMutation109PromoterIqAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
KY901: pMVP (L3-L2) P2A-mCherry + polyA
Plasmid#121766PurposepMVP L3-L2 entry plasmid, contains mCherry-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term mCherry linked by P2A to gene of interest.DepositorInsertP2A-mCherry + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LC402: pMVP (L3-L2) eGFP + polyA
Plasmid#121763PurposepMVP L3-L2 entry plasmid, contains eGFP + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows C-term eGFP fusion to gene of interest.DepositorInserteGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAT-9222
Plasmid#124222PurposeCloning plasmid for EGxFP assay with self-targeting gRNA-sDepositorInsertself-targeting gRNA between EGFP halves
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
IA201: pMAGIC (R4-R3) NLS-Sa dCas9-NLS
Plasmid#121821PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 (nuclease-dead) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KW701: pMVP (L5-L4) AID
Plasmid#121723PurposepMVP L5-L4 entry plasmid, contains AID for 4-component MultiSite Gateway Pro assembly. Allows fusion of minimal N-term Auxin Induced Degron (AID) domain (activated by auxin) to gene of interest.DepositorInsertAID (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
LA201: pMVP (L3-L2) P2A-eCFP + WPRE
Plasmid#121776PurposepMVP L3-L2 entry plasmid, contains eCFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eCFP linked by P2A to gene of interest.DepositorInsertP2A-eCFP + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
II901: pMVP (L5-L4) FKBP DD
Plasmid#121720PurposepMVP L5-L4 entry plasmid, contains FKBP DD for 4-component MultiSite Gateway Pro assembly. Allows fusion of N-term FKBP degron domain (stabilized by SHLD1) to gene of interest.DepositorInsertFKBP Degron Domain (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
HD201: pMVP (L3-L2) IRES-eGFP + polyA
Plasmid#121747PurposepMVP L3-L2 entry plasmid, contains IRES2-eGFP+ polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of eGFP reporter from IRES sequence.DepositorInsertIRES2-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJ4M_hnRNPA2_FL_P298L
Plasmid#139111PurposeExpress FL hnRNPA2 P298L with a C-terminal MBP tagDepositorAvailable SinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
II801: pMVP (L5-L4) ecDHFR DD
Plasmid#121721PurposepMVP L5-L4 entry plasmid, contains ecDHFR DD for 4-component MultiSite Gateway Pro assembly. Allows fusion of N-term ecDHFR degron domain (stabilized by TMP) to gene of interest.DepositorInsertecDHFR Degron Domain (open)
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsXRN1_1174-1649_AH
Plasmid#148903PurposeMammalian Expression of HsXRN1_1174-1649DepositorInsertHsXRN1_1174-1649 (XRN1 Human)
ExpressionMammalianAvailable SinceNov. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
KZ701: pMVP (L3-L2) AID + polyA
Plasmid#121791PurposepMVP L3-L2 entry plasmid, contains AID + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of minimal C-term Auxin Induced Degron (AID) domain (activated by auxin) to geneDepositorInsertAID + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KY801: pMVP (L3-L2) P2A-eGFP + polyA
Plasmid#121764PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + polyA for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest.DepositorInsertP2A-eGFP + polyA
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
NG0888 pCI-TPI-PTC48-HBB
Plasmid#65802PurposeNMD reporter mRNADepositorInsertTPI (TPI1 Human)
TagsHBB (beta-globin 3'UTR for probe binding)ExpressionMammalianMutationpremature stop codon at 48PromoterCMVAvailable SinceSept. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS300A
Plasmid#62526PurposeSerine 300 of Drosha is mutated to alanineDepositorInserthuman Drosha with serine 300 changed to alanine (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 300 to alanineAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-DroshaS302A
Plasmid#62527PurposeSerine 302 of Drosha is mutated to alanineDepositorInserthuman Drosha with serine 302 changed to alanine (DROSHA Human)
TagsGFPExpressionMammalianMutationchanged serine 302 to alanineAvailable SinceMarch 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
JD404: pMVP (L3-L2) BioID2 + WPRE
Plasmid#121797PurposepMVP L3-L2 entry plasmid, contains BioID2 + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows fusion of C-term BioID2 to gene of interest in lentivirus vectors.DepositorInsertBioID2 + WPRE
UseSynthetic Biology; Pmvp gateway entry plasmidAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only