We narrowed to 25,354 results for: SPR
-
Plasmid#113693PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. SapI can be used to clone in gRNAs.DepositorInsertSaCas9 gRNA Cassete
UseAAV and CRISPRAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAT527
Plasmid#180514PurposePlasmid expressing mammalian codon optimized engineered chimeric PlmCasX-R1, mNeonGreen, sgRNAv2 scaffold, and restriction sites to clone in new spacersDepositorInsertsCasX sgRNAv2
PlmCasX with DpbCasX R1 loop-2A-mNeonGreen
UseCRISPRTags2x FLAG and SV40 NLSExpressionMammalianPromoterCAG and U6Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
R711-X12-566: His6-MBP-tev-Hs.NF1iso2 (1203-1530)
Plasmid#159580PurposeE. coli protein expression of His6-MBP-tev-Hs.NF1iso2 (1203-1530)DepositorAvailable SinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterEF1a and U6Available SinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-117G-hyA3A-BE4max
Plasmid#157945PurposeLentiviral expression of hyA3A-BE4maxDepositorInsertLenti-117G- hyA3A-BE4max
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
SECURE miniABEmax-V82G (pJUL1828)
Plasmid#131313PurposeCMV promoter expression plasmid for bpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (miniABEmax with V82G mutation).DepositorInsertbpNLS-TadA7.10(V82G)-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
ExpressionMammalianPromoterCMVAvailable SinceSept. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUFlip-floxed2A-KalTA4-; HE1A:BFP -0
Plasmid#180010PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ96 AAV-SpABE8e-N-terminus_tracrRNA
Plasmid#211817PurposeAAV vector expressing N-terminal of SpCas9-ABE8e and tracrRNADepositorInsertN-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
miniCGBE1-VRQR (pBM1173)
Plasmid#140255PurposeCMV promoter expression plasmid for rAPOBEC1(R33A)-nCas9_VRQR-P2A-EGFPDepositorInsertBE4max(R33A)_VRQR-ΔUGI
ExpressionMammalianMutationR33A in rAPOBEC1, VRQR mutations in SpCas9, D10A …PromoterCMVAvailable SinceAug. 5, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTE4497
Plasmid#80339Purposemammalian expression FnCpf1 nuclease and Fn crRNADepositorInsertsFn crRNA
FnCpf1
UseCRISPRTags3xHA and NLSExpressionMammalianPromoterCMV and human U6Available SinceAug. 29, 2016AvailabilityAcademic Institutions and Nonprofits only