We narrowed to 16,105 results for: grna
-
Plasmid#19680DepositorInsertGateway(R1-R2)-L4440
UseGateway Cloning and RNAiAvailable sinceFeb. 25, 2009AvailabilityAcademic Institutions and Nonprofits only -
MDH1-shSHP2-3-H2Kb2
Plasmid#17854DepositorPublicationAvailable sinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMKO shRNA Bad
Plasmid#17237DepositorAvailable sinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pLV.PARP1#3
Plasmid#14546DepositorPublicationAvailable sinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-SFFV-eBFP2
Plasmid#239601PurposeExpresses either functional CRISPR gRNAs from the hU6-promotor and empowers pairing of CRISPR screens with 3' and 5' scRNA-Seq capturing by FACS-sorting on eBFP2+ without prior resistance selectionDepositorInsertspleen focus‑forming virus - promotor
UseCRISPR and LentiviralExpressionMammalianAvailable sinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
BLaER1 pgRNA CRISPR library
Pooled library#183825PurposePaired gRNA library targeting genes related to B-cell to macrophage transdifferentiation.DepositorSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceAug. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
U6_ISCro4_(WT)_full-length_bridge_RNA_polIII_term
Plasmid#251495PurposeExpression of the native full length ISCro4 bridge RNADepositorInsertISCro4 bridge RNA
ExpressionMammalianMutationNAAvailable sinceFeb. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
pMIIS948-CXCR4
Plasmid#238213PurposeTasR tigRNA expression to target CXCR4 under U6 promoter in human cells.DepositorInserttigRNA
ExpressionMammalianAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_human_ADAR1_ccB
Plasmid#158116Purposedeletion hADAR1DepositorInsertAdar1 (ADAR Human)
ExpressionMammalianAvailable sinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBA615
Plasmid#186239PurposeeLbuCas13a Negative Control (RFP targeting)DepositorInsertpTet-eLbuCas13a + crRNA negative control
ExpressionBacterialAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2 puro - CRBN (#2)
Plasmid#166241PurposesgRNA (#2) to generate a knockout of human CRBN by targeting the start region of Exon1DepositorAvailable sinceDec. 20, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPRv2_RB1#2
Plasmid#174151PurposeLentiviral vector expressing Cas9 and a sgRNA against the human RB1 geneDepositorAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
PEA1-Nuclease-GFP
Plasmid#171994PurposeDelivers all prime editing nuclease components in a single, GFP selectable plasmidDepositorInsertCbH-Cas9-RT-T2A-GFP, hU6-pegRNA (Bbs1 gate), hU6-sgRNA (Bbs1 gate)
ExpressionMammalianMutationGC to CA point mutation in SpCas9 to restore nucl…PromoterCMV for Cas9, U6 for gRNAsAvailable sinceAug. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
rGluA1 (px330:2-guideCas9)
Plasmid#169437PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable sinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgOprk1
Plasmid#159903PurposeMutagenesis of Oprk1DepositorInsertOprk1 (Oprk1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral nontargeting shRNA GFP
Plasmid#155285PurposeLentiviral expression of nontargeting shRNA, GFP expression, based on Addgene 12247DepositorInsertNontargeting shRNA
ExpressionMammalianAvailable sinceSept. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pADsacA
Plasmid#158649PurposeConstitutive transcription of sacA crRNA and GFPDepositorInsertsacA crRNA
UseCRISPR and Synthetic Biology; Shuttle vector baci…ExpressionBacterialPromoterPvegAvailable sinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Lenti-eCas9-sgNT
Plasmid#140238PurposeLentiviral vector expressing high-specificity eSpCas9(1.1) and a control non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-USP10-3'UTR
Plasmid#136056PurposeUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)DepositorAvailable sinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
SiC-V1
Plasmid#133041PurposeSiC-V1 vector with SpCas9 gene and dTomato reporter. sgRNA targeting a gene of interest can be cloned downstream of U6 promoter.DepositorInsertSpCas9
UseCRISPR and LentiviralTagsdTomatoAvailable sinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only