We narrowed to 2,282 results for: mt
-
Plasmid#154336PurposeCrispr repair template: add insertion site specific homology arms by PCR before insertionDepositorInsert30aa linker::GFP::3xFLAG::10aa linker
UseCRISPRExpressionWormAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.SFFV/Flag-NCOA7 variant 6.IRES-puro.WPRE (CG536)
Plasmid#139443PurposeLentiviral vector to ectopically express human NCOA7 isoform 4 from SFFV promoterDepositorInsertFLAG-tag NCOA7 variant 6 (coding for isoform 4, the short, interferon-inducble isoform) (NCOA7 Human)
UseLentiviralTagsFLAGExpressionMammalianPromoterSFFVAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1838
Plasmid#154324PurposesgRNA Destination Vector for SapTrapDepositorInsertSapTrap sgRNA (F+E) vector, K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLP-PIGA3 (pLP305)
Plasmid#196992PurposeBig-IN Landing Pad plasmid encoding pEF1a-driven PuroR-P2A-hmPIGA expression cassette flanked by heterotypic LoxM/LoxP sites, sleeping beauty ITRs and BsmBI homology arms cloning sites.DepositorTypeEmpty backboneUseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceApril 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAR-9.47_VP2_AS
Plasmid#74241PurposeOriginal plasmid described in Choudhury et al, 2015 Mol. Ther. for production of AAV-AS vectors. Encodes VP2_AS chimeric protein with 19 alanines fused to the N-terminus of AAV9.47 VP2.DepositorInsertsAAV2 Rep
AAV9.47-VP2_AS
UseAAVTags19 alanines fused to VP2 of AAV9.47Available SinceApril 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ4M/TDP-43 S48E
Plasmid#104481Purposebacterial expression of TDP-43 S48EDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo-NCOA7g1 (BB34)
Plasmid#139452PurposeLentiviral vector with gRNA targeting human NCOA7 short isoform; includes neomycin selectable markerDepositorInsertNCOA7 short isoform-targeting sgRNA inserted; resistance gene: neoR (NCOA7 Synthetic)
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
CD44-isoform12-CD4d3+4-bio
Plasmid#73130PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding CD44-isoform12 with rat CD4d3+4-bioDepositorInsertCD44 antigen isoform 12 (CD44 Human)
Tagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
TDP-43_NTD1-80_Y4R
Plasmid#104478Purposebacterial expression of TDP-43 NTD Y4RDepositorAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJW1883
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUHD-HA-AML1-ETO
Plasmid#12430DepositorTagsHAExpressionMammalianMutationBstXI-SacII fragment in pUHD-AML1-ETO replaced wi…Available SinceDec. 15, 2006AvailabilityAcademic Institutions and Nonprofits only -
CFP-GIV-CT FA
Plasmid#69533PurposeMammalian expression of The CFP-tagged GIV-CT-FA biosensorsDepositorInsertGIV (CCDC88A Human)
TagsCFPExpressionMammalianMutationC terminal amino acids S1660-S1870 of human GIV w…PromoterCMVAvailable SinceJan. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJW1850
Plasmid#154328PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1849
Plasmid#154327PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCVL.SSA TLR (CCR5 TALEN Sce Spacer)
Plasmid#46941PurposeCodes for the SSA-TLR with the target site for the CCR5 TALEN with the spacer region corresponding to I-Sce I in a lentiviral backboneDepositorInserts5' iRFP arm
eGFP with TALEN TS
+3 mCherry
3' iRFP arm
UseLentiviralExpressionBacterial and MammalianMutationembedded TALEN TS from 163-218, truncated 25 amin…PromoterSFFVAvailable SinceNov. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJW1882
Plasmid#154330PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pJW1851
Plasmid#154329PurposesgRNA Target Vector for CRISPRDepositorInsertcxTi10882 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1927
Plasmid#163093PurposeCRISPR repair template: add insertion site specific homology arms by PCR before insertionDepositorInsertmScarlet-I^SEC (Lox511I)^TEV::AID*::3xFLAG
UseCRISPR and Cre/LoxExpressionWormAvailable SinceJan. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV superYFP-AURKA K162M-mTurq2
Plasmid#157773PurposeExpression of AuroraA kinase-dead biosensor under CMV promoterDepositorInsertAURKA (AURKA Human)
TagsmTurquoise2 and superYFPExpressionMammalianMutationAURKA K162M is a kinase-dead version of AURKAPromoterCMVAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Mouse GFP-PRMT7 LDIG(69-72)AAAA
Plasmid#65044PurposeExpresses Catalytically inactive GFP-PRMT7 LDIG(69-72)AAAA mutantDepositorInsertPRMT7 (Prmt7 Mouse)
UseBacterial propagationTagsGFPExpressionMammalianMutationL69A D70A I71A G72APromoterCMVAvailable SinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-HaloTag
Plasmid#247345PurposeExpresses H2B-Halo under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-IB-H2B-PA-mCherry
Plasmid#247339PurposeExpresses photoactivatable H2B-Cherry under CAG promoter and can be randomly integrated by PiggyBac transposaseDepositorAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-U6-sgRXRa4-1; EF1a-mScarlet
Plasmid#242889PurposeFor lentiviral Crispr/Cas9 mediated knockout of mouse RXRa, using a guide RNA against exon 4, coupled to EF1a-driven mScarletDepositorInsertsgRNA targeting Rxra
UseCRISPR and LentiviralTagsmScarletExpressionMammalianPromoterU6Available SinceAug. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCav1 in pT3TS-Dest
Plasmid#194293PurposeIn vitro transcription of mKate2 tagged zebrafish caveolin1 from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone KZWDepositorInsertcaveolin (cav1.S Frog)
UseIn vitro transcription of mrnaAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
mKate2-DrCavin1a in pT3TS-Dest
Plasmid#194294PurposeIn vitro transcription of mKate2 tagged zebrafish cavin1a from the T3 promoter. The red fluorescent tag is at the N-terminus. Parton lab clone LAIDepositorInsertcavin1a (cavin1a Zebrafish)
UseIn vitro transcription of mrnaAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
p3E-HsNRF2 (NFE2L2)
Plasmid#194302PurposeMultisite gateway entry clone for expression of human NRF2 (NFE2L2) with fusion tag at the N-terminus. Parton lab clone KRSDepositorInsertNFE2L2 (NFE2L2 Human)
UseMultisite gateway entry vectorAvailable SinceDec. 16, 2022AvailabilityAcademic Institutions and Nonprofits only