We narrowed to 70,507 results for: TOR
-
Plasmid#106020PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR37L1; Opto-GPR37L1; B10)DepositorInsertOpto-GPR37L1 (GPR37L1 Bovine, Human)
TagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF467
Plasmid#88643PurposeDonor Vector containing ZNF467 transcription factor, part of the Human TFome CollectionDepositorInsertZNF467 (ZNF467 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AT5G48740 O3_pECIA2
Plasmid#114963PurposeBait vector AT5G48740 O3_pECIA2 should be used with prey vector AT5G48740 O3_pECIA14.DepositorInsertAT5G48740 (AT5G48740 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G59650 O4_pECIA2
Plasmid#114964PurposeBait vector AT5G59650 O4_pECIA2 should be used with prey vector AT5G59650 O4_pECIA14.DepositorInsertAT5G59650 (AT5G59650 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF674
Plasmid#88785PurposeDonor Vector containing ZNF674 transcription factor, part of the Human TFome CollectionDepositorInsertZNF674 (ZNF674 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKCAG-H2BmCherry-OptoJNKi
Plasmid#89741PurposeExpression of light-regulated JNK inhibitor, mCherry-tagged, localised to chromatin with H2B, wild-type photosensor, inhibitor JIP11DepositorInsertOptoJNKi
UseOptogeneticsTagsHistone2B and mCherryExpressionMammalianPromoterCAGAvailable SinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF98
Plasmid#88567PurposeDonor Vector containing ZNF98 transcription factor, part of the Human TFome CollectionDepositorInsertZNF98 (ZNF98 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab7A
Plasmid#135651PurposeRab7A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AR-R405S
Plasmid#126051PurposeExpresses human androgen receptor (R405S) in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF670
Plasmid#88337PurposeDonor Vector containing ZNF670 transcription factor, part of the Human TFome CollectionDepositorInsertZNF670 (ZNF670 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF800
Plasmid#88573PurposeDonor Vector containing ZNF800 transcription factor, part of the Human TFome CollectionDepositorInsertZNF800 (ZNF800 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
IGFALS-bio-His
Plasmid#52180PurposeExpresses full-length Insulin-like growth factor-binding protein complex ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertIGFALS (IGFALS Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF219
Plasmid#88118PurposeDonor Vector containing ZNF219 transcription factor, part of the Human TFome CollectionDepositorInsertZNF219 (ZNF219 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF830
Plasmid#88342PurposeDonor Vector containing ZNF830 transcription factor, part of the Human TFome CollectionDepositorInsertZNF830 (ZNF830 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ZNF808
Plasmid#101470PurposeDonor Vector containing ZNF808 transcription factor, part of the Human TFome CollectionDepositorInsertZNF808 (ZNF808 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF331
Plasmid#88442PurposeDonor Vector containing ZNF331 transcription factor, part of the Human TFome CollectionDepositorInsertZNF331 (ZNF331 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF698
Plasmid#88666PurposeDonor Vector containing ZNF698 transcription factor, part of the Human TFome CollectionDepositorInsertZNF698 (ZFP57 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF232
Plasmid#88305PurposeDonor Vector containing ZNF232 transcription factor, part of the Human TFome CollectionDepositorInsertZNF232 (ZNF232 Human)
UseGateway CloningMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only