We narrowed to 11,961 results for: CHL
-
Plasmid#206789PurposeMammalian Expression of Cavbeta1 Ca2+ channel scFV. Derived from hybridoma N7/18 scFv.DepositorInsertCavbeta1 Ca2+ channel (Homo sapiens) recombinant scFV (CACNB1 Mouse)
ExpressionMammalianPromoterCMVAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-ChR2(H134R)-eYFP
Plasmid#127090PurposeCre-dependent AAV expression of humanized ChR2 (with H134R mutation) fused to eYFP for optogenetic activationDepositorHas ServiceAAV PHP.eBInsertChannelrhodopsin-2
UseAAVTagseYFP (C terminal on insert)ExpressionMammalianMutationHumanized ChR2 gene with histidine 134 changed to…PromoterCAGAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLX304-GW-DCK*-IRES-GFP
Plasmid#176291PurposeGateway vector for use in generating POI-DCK* fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-GW-IRES-GFP
Plasmid#176289PurposeGateway vector for use in generating DCK*-POI fusion reporterDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable SinceMarch 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
plenti-FLAG-CAMK2D-ED
Plasmid#221700PurposeLentiviral expression of FLAG-tagged human CAMK2D (K43R/D136N) in mammalian cellsDepositorAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-FSF-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65454PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Flp and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPMutationH134R variantPromoterhSyn1Available SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCC1-4k-BBclone2
Plasmid#137070PurposeE. coli plasmid that contains the expression optimized genes for BB0323, P13, DipA and Lmp1DepositorInsertsBB0323
P13
DipA
Lmp1
ExpressionBacterialMutationwild-type, full-length (signal-peptide-containing…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1-RSR-FLEX-ChR2(H134R)-EYFP-WPRE-bGHpA
Plasmid#65429PurposeCan be used to generate AAV virus that will express the ChR2(H134R)-EYFP channelrhodopsin fusion protein in neurons under intersectional control by Dre and Cre recombinasesDepositorInsertChR2(H134R)-EYFP
UseAAVTagsEYFPMutationH134R variantPromoterhSyn1Available SinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pOTTC468 - pAAV EF1a DIO hChR2(H134R)-iRFP
Plasmid#47633PurposeAn AAV vector that expresses channel rhodopsin 2 (H134R) (fused to iRFP) in a Cre-dependent manner (DIO, double floxed inverted open reading frame).DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsiRFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceSept. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-His6-3xFlag/nsp7/nsp8 (SARS-CoV-2)
Plasmid#169185PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag, nsp7 and nsp8 (SARS-CoV-2) in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7/nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Spike Display_Part 2 Spacer
Plasmid#172730PurposeEncodes Part 2 of HexaPro-D614G spike to be used in the Spike Display systemDepositorInsertSARS-CoV-2 S HexaPro-D614G (S Severe acute respiratory syndrome coronavirus 2)
UseSynthetic BiologyMutationEctodomain only (AAs 1-1208); 682-685 (furin site…Available SinceAug. 17, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBIG2abc_nsp12-His6-3xFlag/nsp7-Linker-nsp8 (SARS-CoV-2)
Plasmid#169184PurposeBaculoviral transfer vector to co-express nsp12-His6-3xFlag and nsp7-Linker-nsp8 fusion in insect cellsDepositorInsertnsp12-His6-3xFlag/nsp7-Linker-nsp8 (ORF1ab SARS-CoV-2, Synthetic)
TagsHis6-3xFlag (nsp12 C-terminus) and nsp7-nsp8 fusi…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBIG2abc_nsp12-3xFlag/nsp7-His6-nsp8 (SARS-CoV-2)
Plasmid#169183PurposeBaculoviral transfer vector to co-express nsp12-3xFlag and nsp7-His6-nsp8 fusion in insect cellsDepositorInsertnsp12-3xFlag/nsp7-His6-nsp8 (ORF1ab SARS-CoV-2)
Tags3xFlag (nsp12 C-terminus) and His6 (as internal t…ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
Anti-Cavbeta1 Ca2+ channel [N7/18.1R]
Plasmid#114497PurposeMammalian Expression Plasmid of anti-Cavbeta1 Ca2+ channel (Human). Derived from hybridoma N7/18.1.DepositorInsertanti-Cavbeta1 Ca2+ channel (Home sapiens) recombinant mouse monoclonal antibody (CACNB1 Mouse)
ExpressionMammalianPromoterdual CMVAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1784 - pAAV SYN1 hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201820PurposeAn adeno-associated viral vector expressing channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PET imagingDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_p.N299S
Plasmid#81572PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_BAP1_p.D75G
Plasmid#81526PurposeGateway Donor vector containing BAP1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBIG2ab_nsp14/nsp10-6His-3xFlag (SARS-CoV-2)
Plasmid#169164PurposeBaculoviral transfer vector to co-express SARS-CoV-2 nsp14 and nsp10 in insect cellsDepositorInsertnsp14/nsp10-6His-3xFlag (ORF1ab SARS-CoV-2, Synthetic)
Tags6His-3xFlag (nsp10 C-terminus)ExpressionInsectMutationCodon optimised for insect cells (Spodoptera frug…PromoterPolyhedrinAvailable SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1822 - pAAV SYN1 DIO hChR2(H134R)-V5-ER-LBD (ChRERa)
Plasmid#201821PurposeAn adeno-associated viral vector expressing Cre-dependent channelrhodopsin-2 fused to a V5 epitope and the ligand-binding domain of estrogen receptor (ChRERa) from a synapsin promoter, for use in PETDepositorInserthChR2(H134R)-V5-ER-LBD (ChRERa)
UseAAVPromoterSYN1Available SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only