We narrowed to 30,938 results for: TRO
-
Plasmid#46844PurposeTemplate for the amplification of spiking anchors in BeSDDepositorTypeEmpty backboneUseIn vitro expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only
-
AAV-GFABC1D-GJA1-GGGGS-TID-HA
Plasmid#252501PurposeExpresses Cx43/TurboID/HA fusion protein under a shortened GFAP promoterDepositorInsertsTags3xGGGGS, HA, and TurboIDExpressionMammalianMutationdeleted stop codonAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
MSCV-BCR-ABL1-p190-IRES-EGFP
Plasmid#219964PurposeExpress human BCR-ABL1-P190 in mammalian cellsDepositorAvailable SinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
2xMARS
Plasmid#205233PurposeExpresses two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to mScarlet-iin mammalian cellsDepositorInserttwo repeats of PLEKHA5 aa 143-271 with K163A and R164A mutations (PLEKHA5 Human)
TagsNuclear Export Sequence and mScarlet-iExpressionMammalianMutationamino acids 143-271 of PLEKHA5 (GenBank reference…PromoterCMVAvailable SinceJuly 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEC2935 (p7INT-P23_mNeongreen~ssrA (LDD variant))
Plasmid#218508Purposeintegrative plasmid enabling constitutive expression of a destabilized mNeongreen reporter in Streptococcus pyogenes, targets the attP site of phage T12 in several S. pyogenes strains via an integraseDepositorInsertmNeongreen
Tagsmodified ssrA degradation tagExpressionBacterialMutationdeletion of MCS containing Plac_lacZa, introducti…PromoterP23Available SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFP5370 ss-FIREmate-HA- KDEL-IVS-IRES- TNF-SBP- mCherry-FIREtag
Plasmid#216696PurposeSynchronize trafficking of TNFalpha from the ER (RUCH system)DepositorInsertsFIREmate-KDEL
Tumor Necrosis Factor alpha (TNFa)
TagsFIREtag, Streptavidin Binding Protein (SBP), and …ExpressionMammalianPromoterCMVAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
VPS26C_pcDNA6.2/EmGFP-Bsd
Plasmid#176982PurposeMammalian expression vector encoding VPS26C and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEXPqcxip-hCCDC47-FLAG
Plasmid#159141PurposeHu CCDC47 -flag mammalian expression Gateway vector.DepositorInsertcoiled-coil domain containing 47 (CCDC47 Human)
UseRetroviralTagsFLAGExpressionMammalianPromoterCMV (cytomegalovirus) enhancer and the MSV (mouse…Available SinceMarch 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-RsSHC014-RBD-8h
Plasmid#161826PurposeMammalian expression plasmid for RBD of bat coronavirus isolate RsSHC014DepositorInsertReceptor-binding domain (RBD) of spike protein S
TagsGSG linker and 8his tag and HA leader sequenceExpressionMammalianMutationHuman codon optimized RBD (a.a. T321-D519)PromoterCMVAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Rs7327-RBD-8h
Plasmid#161823PurposeMammalian expression plasmid for RBD of bat coronavirus isolate Rs7327DepositorInsertReceptor-binding domain (RBD) of spike protein S
TagsGSG linker and 8his tag and HA leader sequenceExpressionMammalianMutationHuman codon optimized RBD (a.a. T321-D519)PromoterCMVAvailable SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Dom neg CstF64
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
CaMKIV-DCTK75E
Plasmid#126423PurposeA kinase-dead mutant of CaMK IV (C-terminal regulatory domains removed making the enzyme constitutively active)DepositorInsertcalcium/calmodulin-dependent protein kinase IV kinase-dead mutant (CAMK4 Human)
TagsFLAGExpressionMammalianMutationchanged lysine 75 to glutamic acidAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-Neo-TetO-Cdk12_Nterm_FlagHa
Plasmid#127179PurposeN-terminal Flag- HA- tandem epitope tagged mouse Cdk12 transgene (NM_001109626.1 isoform) cloned into a dox-inducible piggybac destination vectorDepositorInsertN-terminally Flag- HA- Epitope Tagged Mouse Cyclin Dependent Kinase 12 (Cdk12 Mouse)
UsePiggybac transposase vectorTagsFlag- HA- Tandem EpitopesExpressionMammalianPromoterTetO PromoterAvailable SinceJuly 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB123 - pL0_rLUC-I (CDS1)
Plasmid#123181PurposeGolden Gate (MoClo; CDS1) compatible luciferase gene from Renilla reniformis with an intron for transient and stable expression in plantsDepositorInsertluciferase gene from Renilla reniformis with an plant intron and codon optimized for plants
UseLuciferase; Part for plant expressionExpressionPlantMutationNo BpiI and BsaI sites; codon-optimised for plantsAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 FS1
Plasmid#113955Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of influenza hemagglutinin; expression-enhanced variantDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from influenza he…ExpressionMammalianMutationdelete N-terminal 21 residues, one base pair dele…PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCS6-ZF(VEGFA)-StaPL(TI)-tdRFP-KRAB
Plasmid#111504PurposeExpresses a zinc finger specific to the human VEGFA locus, which is linked to a KRAB transcriptional repression domain via a StaPL(TI) module, in mammalian cells. [TI = telaprevir inhibited].DepositorInsertZF(VEGFA)-StaPL(TI)-tdRFP-KRAB
ExpressionMammalianMutationThe HCV NS3 protease carries F43L, Q80K, S122R, a…PromoterCMVAvailable SinceJuly 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-GRM3-VN
Plasmid#98965PurposeFLAG-tagged human mGluR3 fused to N-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsFLAG (dykddddk) epitope tag, Signal/leader sequen…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMIG-hH4-AVITEV
Plasmid#74051Purposeretroviral expression plasmid for human histone H4 with C-terminal BirA-biotinylation signal and TEV celavage siteDepositorInserthuman Histone-H4 (H4C16 Human)
UseRetroviralTagsAVI-TEVExpressionMammalianPromoterpMSCV-LTRsAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 (+) FLAG-Ago2 S387E
Plasmid#60653PurposeExpresses CMV-FLAG-Ago2 (N-term tag) S387E mutant in mammalian cellsDepositorInsertArgonaute 2 (AGO2 Human)
TagsCMV-FLAG-Ago2 (N-term tag)ExpressionMammalianMutationS387E mutantPromoterCMVAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.1 (+) FLAG-Ago2 S387A
Plasmid#60652PurposeExpresses CMV-FLAG-Ago2 (N-term tag) S387A mutant in mammalian cellsDepositorAvailable SinceDec. 14, 2015AvailabilityAcademic Institutions and Nonprofits only