We narrowed to 69,982 results for: TOR;
-
Plasmid#115052PurposeBait vector AT1G06840 X062_pECIA2 should be used with prey vector AT1G06840 X062_pECIA14.DepositorInsertAT1G06840 (AT1G06840 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT2G19230 M11_pECIA2
Plasmid#114949PurposeBait vector AT2G19230 M11_pECIA2 should be used with prey vector AT2G19230 M11_pECIA14.DepositorInsertAT2G19230 (AT2G19230 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G29730 X066_pECIA14
Plasmid#114855PurposePrey vector AT1G29730 X066_pECIA14 should be used with bait vector AT1G29730 X066_pECIA2.DepositorInsertAT1G29730 (AT1G29730 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT3G02880 J3_pECIA14
Plasmid#114790PurposePrey vector AT3G02880 J3_pECIA14 should be used with bait vector AT3G02880 J3_pECIA2.DepositorInsertAT3G02880 (AT3G02880 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT1G51890 M5_pECIA14
Plasmid#114744PurposePrey vector AT1G51890 M5_pECIA14 should be used with bait vector AT1G51890 M5_pECIA2.DepositorInsertAT1G51890 (AT1G51890 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pS6-TGFB2-STREP
Plasmid#128503PurposeExpresses human pro-TGFβ2 (from L21 to S414) in mammalian cells. With N-t STREP(2x) tag.DepositorAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
Gal4-VP16-HSF1 WT
Plasmid#71726Purposeplasmid expressing fusion construct of Gal4 BDB VP16 AD and HSF1 WT RDDepositorInsertGal4 DBD HSF1 VP16 AD (HSF1 Herpes Simplex Virus protein VP16, Human, Budding Yeast)
ExpressionMammalianAvailable SinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
AT1G66830 X005_pECIA14
Plasmid#114810PurposePrey vector AT1G66830 X005_pECIA14 should be used with bait vector AT1G66830 X005_pECIA2.DepositorInsertAT1G66830 (AT1G66830 Mustard Weed)
ExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta2-29
Plasmid#124923PurposeFor expression of a.a.2-29 deletion mutant of SIN1-GFPDepositorInsertMAPKAP1 (MAPKAP1 Human)
TagsTagGFP2ExpressionMammalianMutationInsert ORF was sirently mutated to be resistent t…Available SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
AT5G48740 O3_pECIA2
Plasmid#114963PurposeBait vector AT5G48740 O3_pECIA2 should be used with prey vector AT5G48740 O3_pECIA14.DepositorInsertAT5G48740 (AT5G48740 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
AT5G59650 O4_pECIA2
Plasmid#114964PurposeBait vector AT5G59650 O4_pECIA2 should be used with prey vector AT5G59650 O4_pECIA14.DepositorInsertAT5G59650 (AT5G59650 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBS L30 Ruby3-Rab7A
Plasmid#135651PurposeRab7A fused to the red fluorescent protein Ruby3 in N-ter under control of a weak L30 promoter.DepositorAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR-W741C-S81A
Plasmid#171248PurposeMammalian expression of 3xFlag-tagged human androgen receptor phosphorylation mutant that binds to bicalutamide: AR-Trp741Cys-Ser81Ala (AR-W741C-S81A)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys-Ser81Ala mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys-Ser81Ala (AR-W741C-S81A)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-M4-AR-W741C-S81D
Plasmid#171249PurposeMammalian expression of 3xFlag-tagged human androgen receptor phosphorylation mutant that binds to bicalutamide: AR-Trp741Cys-Ser81Asp (AR-W741C-S81D)DepositorInsert3xFlag-tagged human androgen receptor Trp741Cys-Ser81Asp mutant (AR Human)
TagsFlagExpressionMammalianMutationAR-Trp741Cys-Ser81Asp (AR-W741C-S81D)PromoterCMVAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AR-R405S
Plasmid#126051PurposeExpresses human androgen receptor (R405S) in mammalian cellsDepositorAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A-PIK3CA E545K
Plasmid#180032PurposeEntry vector of PIK3CA E545K for gateway cloning.DepositorAvailable SinceMarch 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3XFLAG-wtGATA6-3XAU1_RNAi resistant
Plasmid#72922PurposeGateway entry vector for an inducible N-terminally 3XFLAG-tagged and C-terminally AU1-tagged, RNAi resistant human wtGATA6DepositorInsertGATA Binding Protein 6 (GATA6 Human)
UseEntry vector for gateway cloningTags3XAU1 and 3XFLAGExpressionBacterialPromoterTRE tightAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only