We narrowed to 24,213 results for: Spr
-
-
-
-
-
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262-ABE8e
Plasmid#161523PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE8e mediated A-G base editingDepositorInsertABE8e-zSpCas9(D10A)
UseCRISPR; Gateway compatible abe8e-zspcas9(d10a) en…TagsExpressionPlantMutationPromoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m
Plasmid#161522PurposeGateway entry clone (attL1 & attR5) for CRISPR-zSpCas9 ABE7.10 mediated A-G base editingDepositorInsertTadA(wt)-TadA(7.10)-zSpCas9(D10A)
UseCRISPR; Gateway compatible tada(wt)-tada(7.10)-zs…TagsExpressionPlantMutationPromoterAvailable sinceFeb. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
FASTHDR-tRNApromo-sgRNA-espCas91_1
Plasmid#167210PurposePlasmid for easy cloning of a sgRNA sequence. The Plasmid contain a tRNA promoter to facilitate the expression of any sgRNA sequence and also expresses eSpCas9(1.1)DepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceDec. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CASANOVA
Plasmid#113035PurposeCASANOVA (AcrIIA4-LOV2 hybrid) expression in mammalian cells; enables optogenetic control of SpyCas9DepositorInsertCASANOVA (for CRISPR/Cas9 activity switching via a novel optogenetic variant of AcrIIA4)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pST_140_LVL2 cam
Plasmid#179334PurposeNT-CRISPR plasmid for a single gRNA with spG Cas9 (near PAM-less Cas9 variant).DepositorInsertPtac tfoX, Ptet spG cas9, PJ23106 acrIIA4, Ptet gRNA with sfGFP dropout
UseCRISPRTagsExpressionMutationCas9 -> SpG Cas9 (D1135L, S1136W, G1218K, E121…PromoterAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pErCas12a EZ Clone
Plasmid#132641PurposeExpresses ErCas12a and an sgRNA to target a region of interestDepositorInsertErCas12a
UseAAV and CRISPRTags3x HA and SV40 NLSExpressionMammalianMutationQ926R (Please see depositor comments) and BsaI si…PromoterCMV PromoterAvailable sinceApril 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
-
-
-
-
-