-
Plasmid#87401PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YOLCd1b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-CAN1y
Plasmid#87391PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting CAN1y
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pD10AH840AhCas9 (GB1041)
Plasmid#68207PurposeProvides the human codon optimized CDS of Cas9 protein with mutated (D10A, H840A) and inactivated catalytic domains as a level 0 GoldenBraid partDepositorInsertCas9 coding region with mutated (D10A, H840A) and inactivated catalytic domains (human codon optimised)
UseCRISPR and Synthetic BiologyTagsExpressionMutationBsaI and BsmBI sites removed; human codon optimis…PromoterAvailable sinceMarch 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
helicase cDNA
Plasmid#39552DepositorInserthelicase (Hel25E Fly)
UseTagsExpressionMutationPromoterAvailable sinceJan. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
RCAS (A) cPitx1 (CT#70)
Plasmid#13871DepositorInsertpitx1 (PITX1 Chicken)
UseRetroviral; Avian expressionTagsExpressionMutationPromoterAvailable sinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCaSpeR-hs-taiman
Plasmid#17585DepositorInserttaiman (tai Fly)
UseTagsExpressionInsectMutationPromoterAvailable sinceNov. 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT3TS-Hf-RfxCas13d-HA
Plasmid#234479PurposePlasmid to carry out IVT of High-fidelity RfxCas13d (human codon-optimized)DepositorInsertRfxCas13d
UseCRISPRTagsHAExpressionMutationChanged four alanine to valine in positions 134, …PromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
dCas9-EGFP
Plasmid#232761PurposeExpresses dCas9-EGFPDepositorInsertdCas9-EGFP
UseLentiviralTagsExpressionMutationPromoterEF1aAvailable sinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iC
Plasmid#231418PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-C1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ290.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET_StrepII_TEV_LIC_TniQ(PmcCAST)
Plasmid#224927PurposeTniQ expression plasmid for the co-purification of TnsC-TniQ complexDepositorInsertTniQ
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable sinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_CMV_MeltCasp1-37-GFP
Plasmid#234069PurposeEncodes the caspase1 without CARD domain (with R391K mutation) controlled by a Melt variant with a switching temperature of 37°CDepositorInsertMeltCasp1-37-GFP
UseLentiviralTagsExpressionMammalianMutationMelt(C292A,Q355N); hcaspase1(R391K)PromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-DDX3_helicase_core_Q360L
Plasmid#233619PurposeExpression of His-tagged helicase core region of DDX3X with Q360L mutation in E.coliDepositorInsertDDX3X helicase core Gln360Leu (DDX3X Human)
UseTagsHis6ExpressionBacterialMutationGln360LeuPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-DDX3_helicase_core_Q360P
Plasmid#233620PurposeExpression of His-tagged helicase core region of DDX3X with Q360P mutation in E.coliDepositorInsertDDX3X helicase core Gln360Pro (DDX3X Human)
UseTagsHis6ExpressionBacterialMutationGln360ProPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pColdI-DDX3_helicase_core
Plasmid#233618PurposeExpression of His-tagged helicase core region of DDX3X in E.coliDepositorInsertDDX3X helicase core WT (DDX3X Human)
UseTagsHis6ExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-tdTomato
Plasmid#232631Purposecatalytically inactive dCas9 for localization; labeled with tdTomatoDepositorInsertdCas9-tdTomato
UseCRISPRTagsNLSExpressionMammalianMutationnonePromoterCMV (TATA box removed)Available sinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_AAN_4
Plasmid#231415PurposeThis AND-AND-NOT-gate plasmid expresses dCas9 from a constitutive promoter. Its sgRNAs X & Y are repressible by sgRNAs A & B, respectively. Its GFP gene is repressible by any of sgRNAs X, Y, and C.DepositorInsertsdCas9
GFP
sgRNA-X
sgRNA-Y
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_iA
Plasmid#231417PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-A1. (This plasmid is a gift of the Jaramillo Lab, where it is called PAJ285.)DepositorInsertsdCas9
GFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_YES_i2
Plasmid#231419PurposeThis YES-gate plasmid expresses dCas9 from a constitutive promoter, GFP from a promoter repressible by sgRNA-Y, and sgRNA-Y repressible by sgRNA-2.DepositorInsertsdCas9
GFP
sgRNA-Y
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA47_dCas9-GFP_NOT_i1
Plasmid#231416PurposeThis NOT-gate plasmid expresses dCas9 from a constitutive promoter, and GFP from a promoter repressible by sgRNA-1.DepositorInsertsdCas9
GFP
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only