We narrowed to 40,469 results for: tat
-
Plasmid#49855PurposeEncodes human connexin 43 with M100 and M125 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100 and Methionine 125 mutated to Leuci…PromoterCMVAvailable SinceJan. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
CAG-Cas9-T2A-EGFP-ires-puro
Plasmid#78311PurposeExpresses WT SpCas9, EGFP and Puromycin resistance from a CAG promoter.DepositorInsertWT SpCas9-T2A-EGFP-ires-puromycin resistance
UseCRISPRTagsT2A-EGFP-ires-puroExpressionMammalianPromoterCAGAvailable SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTriEx-PA-Rac1-I539E
Plasmid#22026PurposeExpression of photoactivatable Rac1 ('lit' state mutant)DepositorInsertPA-Rac1-I539E (RAC1 Avena sativa (oat), Human)
Tags6X HisExpressionBacterial, Insect, and Mamm…MutationLOV domain contains 'lit state' mutatio…PromoterCMV, p10Available SinceSept. 29, 2009AvailabilityAcademic Institutions and Nonprofits only -
retro-gfp-puro vector
Plasmid#58249PurposeRetroviral expression vector encoding bicistronic EGFP and Puromycin cassetteDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A)
Plasmid#55798PurposeIn addition to the mutations in alpha-s(alpha3beta5), this dominant negative G protein alpha-s mutant contains the G226A mutation, which impairs activating conformation changes in Switch II.DepositorInsertalpha-s (alpha3beta5/G226A) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A in alpha…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
Plasmid#110300PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2-Cx43-M100/125/147/213-siResist
Plasmid#49858PurposeEncodes human connexin 43 with M100, M125, M147, and M213 mutated to L and wobble mutations conferring resistance against an siRNADepositorInsertConnexin 43 (GJA1 Human)
ExpressionMammalianMutationMethionine100, Methionine 125, Methionine 147, an…PromoterCMVAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode20
Plasmid#226192PurposeExpression mappingDepositorInsertSyn Barcode20
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-GFP
Plasmid#66080PurposeThis G protein alpha-q construct contains internal insertions of GFP and the EE epitopeDepositorInsertG protein alpha-q-EE-YFP (Gnaq Mouse)
TagsGFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-s(alpha3beta5/G226A/A366S)
Plasmid#55797PurposeThis highly effective dominant negative G protein alpha-s mutant contains, in addition to the mutations in alpha-s(alpha3beta5/G226A), the A366S mutation, which increases GDP release.DepositorInsertalpha-s (alpha3beta5/G226A/A366S) (Gnas Rat)
Tagsinternal EE epitope (residues 189-194 in alpha-s …ExpressionMammalianMutationN271K, K274D, R280K, T284D, I285T, G226A, A366S i…PromoterCMVAvailable SinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPB-tetO(hCMV1)-HA-Tet1mHxD(201R2)-IV
Plasmid#102422PurposeInducible expression of siRNA resistant mouse Tet1-201 (ENSMUST00000050826.13) with mutated catalytic domain (H1620Y & D1622A), HA-tag and IRES-Venus in piggyBac (PB) transposon vectorDepositorInsertTet1 catalytic domain mutant (Tet1 Mouse)
TagsHAExpressionMammalianMutationH1620Y and D1622A mutations in Tet1 catalytic dom…PromoterTetO-CMVAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
G protein alpha-q-CFP
Plasmid#66081PurposeThis G protein alpha-q construct contains internal insertions of CFP and the EE epitopeDepositorInsertG protein alpha-q-EE-CFP (Gnaq Mouse)
TagsCFP was inserted internally into the alpha-q sequ…ExpressionMammalianMutationBamHI and SacI sites in alpha-q were removed with…PromoterCMVAvailable SinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
hSyn Marina-T2A-nls-mCherry
Plasmid#85843Purposegenetically-encoded fluorescent voltage indicatorDepositorInsertGEVI Marina
TagsmCherryExpressionMammalianMutationCi-VSP contains R217Q mutation; super ecliptic pH…PromoterhSyn1Available SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Antibody#211752-rAbPurposeAnti-LPL (Human) recombinant mouse monoclonal antibodyDepositorRecommended ApplicationsWestern BlotReactivityHumanSource SpeciesMouseIsotypeIgG2aTrial SizeAvailable to purchaseAvailable SinceJune 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12V/sgKras/Cre
Plasmid#99854PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13R/sgKras/Cre
Plasmid#99858PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBABEpuro-ERBB2
Plasmid#40978DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only