We narrowed to 6,006 results for: pCas
-
Plasmid#109126PurposeCation channelrhodopsin ChETA fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChETA-mRuby2-ST
ExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Ace2_D92N_E199V-mRuby3-ST
Plasmid#129262PurposeExpress soma-localized Ace2_D92N_E199V-mRuby3 in mammalian cellsDepositorInsertAce2_D92N_E199V-mRuby3-ST
ExpressionMammalianMutationD92N, E199VPromoterCAGAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS9-mCherry-ACTG1
Plasmid#66943PurposeCRISPaint target selector ACTG1DepositorInsertgRNA ACTG1
Available SinceSept. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-Chronos-mRuby2-ST
Plasmid#105446PurposeCation channelrhodopsin Chronos fused to mRuby2 fluorophore and targeted to the neuronal soma and proximal dendritesDepositorInsertChronos-mRuby2-ST
TagsmRuby2 and soma targeting motifPromoterpCAGGSAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-TSSK2/3xFLAG
Plasmid#199625PurposeExpression vector of mouse TSSK2. 3xFLAG tag at C-terminus.DepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR9/9*
Plasmid#177805PurposeThe pre-miR-9/9* sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-9/9*
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eGtACR1-mRuby2-ST
Plasmid#109136PurposeAnion channelrhodopsin GtACR1 fused to ER export signal, mRuby2 and targeted to the neuronal soma and proximal dendritesDepositorInserteGtACR1-mRuby2-ST
ExpressionMammalianPromoterCAGAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-S-B.1.617.2-FLAG
Plasmid#177097PurposeB.1.617.2 variant S-protein with c-terminal FLAG tagDepositorAvailable SinceNov. 2, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCAGGS-GCaMP2-actin
Plasmid#18928DepositorAvailable SinceSept. 3, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCAG-PxCas12a-2AeGFP
Plasmid#123637PurposeMammalian expression, Genome editingDepositorInsertPxCas12a
Tags3xHA tagExpressionMammalianAvailable SinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGL3-B-161;+80pCalb2
Plasmid#66745Purposeluciferase reporter for Calb2 promoter (-161to +80, WT)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i4 sgRNA / hSpCas9
Plasmid#172828PurposeMammalian expression of a sgRNA targeting the intron 1 position 4 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9-beta-mmr
Plasmid#169241PurposeCas9, beta, and mutL mutant expression plasmid for introducing chromosomal point mutationsDepositorInsertscas9
beta
mutL-E36K
UseCRISPR and Synthetic BiologyExpressionBacterialMutationChanged glutamic acid 36 to lysineAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AkCas12b-2AeGFP
Plasmid#121946PurposeMammalian expression, Genome editingDepositorInsertAkCas12b
Tags3xHA tagExpressionMammalianAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-miR124
Plasmid#177806PurposeThe pre-miR-124 sequence has been inserted into the EcoRV of pCAG-nDsRedFL-intron.DepositorInsertmiR-124
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mDrc7-FLAG
Plasmid#176470PurposeExpression vector of mouse dynein regulatory complex subunit 7 (Drc7) tagged with FLAG at C-terminus.DepositorInsertdynein regulatory complex subunit 7 (Drc7 Mouse)
TagsFLAGExpressionMammalianPromoterCAG promoterAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9–mKate2ps–CgRNA
Plasmid#64955PurposeControl gRNA (GTCAAGGCACTCTTGCCTA)DepositorInsertCas9–mKate2ps
ExpressionMammalianAvailable SinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only