We narrowed to 9,093 results for: sgRNA
-
Plasmid#254885PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting PRPF39DepositorInsertTwo sgRNAs targeting PRPF39
UseCRISPR and LentiviralPromoterU6/7SKAvailable SinceJune 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCF820-sgNT-1_U6-sgRNA-EF1a-mCherry2
Plasmid#211648PurposeU6-sgRNA-EF1a-mCherry2DepositorInsertNon-targeting control sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-Sox3gRNA-T2
Plasmid#127778PurposeChicken sox3 gRNA target site 2, cloned into the pU6 sgRNA (backbone #92359)DepositorInsertsox3gRNAT2
UseCRISPRAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pICSL11057
Plasmid#68253PurposeLevel 1 Golden Gate Cassette: sgRNA cassette targeting PM19_1 in barleyDepositorInsertPromote:TaU6+sgRNA HvPM19_1
UseSynthetic BiologyExpressionPlantAvailable SinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV U6-sgRNA UbC-GFP
Plasmid#106948PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with GFP markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorAvailable SinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #1
Plasmid#179454PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #2
Plasmid#179455PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCrisprV2 sgRNA hPER2c-term #3
Plasmid#179456PurposeLentiviral Crispr/Cas9 plasmid targeting hPER2 at C-terminus to generate C-terminal knock-inDepositorInsertsgRNA targeting human PER2
UseCRISPR and LentiviralPromoterhU6Available SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMP1187
Plasmid#119256Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC40
Plasmid#62334PurposesgRNA + 2x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 2x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_M2S_AmpR
Plasmid#119154PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanR with two mismatches in the seed regionDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR, with two mismatches in the seed region
UseCrisprPromoterJ23119Available SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTAG1
Plasmid#176863PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_1
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTAG2E
Plasmid#176865PurposeFirst sgRNA in a tRNA separated array of sgRNAsDepositorInsertsgRNA_2E
UseCRISPRMutationWTAvailable SinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC545
Plasmid#62313PurposesgRNA with 1x MS2 for yeast cellsDepositorInsertsgRNA + 1x MS2 binding module
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBHM2650
Plasmid#229992PurposeCarries AID* tag, empty sgRNA, and HYGR markerDepositorInsertAID* - empty sgRNA - HYGR
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBHM2652
Plasmid#229994PurposeCarries AID* tag, empty sgRNA, and amdS markerDepositorInsertAID* - empty sgRNA - amdS
Tags2xFLAGExpressionBacterial and YeastAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2_mClover3_LacZ
Plasmid#155103Purposelentiviral plasmid expressing mClover3, Cas9 and a gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9-@GL1
Plasmid#86779PurposeDisruption of GLABROUS1 gene in Arabidopsis using CRISPR/Cas9DepositorInsertsgRNA against GLABROUS1
UseSynthetic BiologyExpressionPlantPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only