We narrowed to 81,441 results for: Tro;
-
Plasmid#180279PurposePlasmid encoding the human protease OTUB1 without a tag. Polycistronic red fluorescent retroviral vector (unmodified from TAKARA BIO).DepositorAvailable SinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only
-
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-3P-ECM33_intron
Plasmid#127601Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 3P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 3′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5M-ECM33_intron
Plasmid#127600Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5M-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins replacing sequence near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-5P-ECM33_intron
Plasmid#127599Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, 5P-ECM33 intron inserted into URA3DepositorInsertECM33 intron with MS2 hairpins inserted near 5′ end of intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-ECM33_intron
Plasmid#127598Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoter, ECM33 intron inserted into URA3DepositorInsertECM33 intron
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS416-PTEF1-MCP-no_intron
Plasmid#127597Purposelow-copy URA-selectable plasmid, 1xFLAG-MCP under TEF1 promoterDepositorInsert1xFLAG-MCP expression cassette
ExpressionYeastAvailable SinceApril 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVsc.U6-sgFah.Intron9.CMV/CB-EGFP
Plasmid#121509PurposeExpresses sgRNA targeting mouse Fah intron 9 (sgFah.Intron9).DepositorInsertsgFah.intron9
UseAAVExpressionMammalianPromoterU6Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh1
Plasmid#92033PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #1 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-SIRPT1-Jatropha curcas
Plasmid#75327PurposeGST fusion Jatropha curcas Sacsin 1-1304DepositorInsertSacsin Jatropha-curcas 1-1304
TagsGST-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pColdII-SIRPT1-Jatropha curcas
Plasmid#75359PurposeNt His-tag Jatropha curcas Sacsin 1-1304DepositorInsertSacsin Jatropha-curcas 1-1304
TagsHis-TagExpressionBacterialAvailable SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRRP51A+intron-LacZ (pHZ18)
Plasmid#33131DepositorInsertRP51A+intron-LacZ (RPS17A Budding Yeast)
ExpressionYeastAvailable SinceDec. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mCherry-Jph3 WPRE
Plasmid#236237PurposeAAV expression of human Junctophilin3 N-terminally tagged with mCherryDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-Trono-EFS-Blast-P2A-TurboRFP
Plasmid#228893PurposeCloning and expression of gRNAs or pegRNAs with EcoRI/Esp3I insertion.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CycK-GFP (1-270AA) in Cilantro (Codon optimized)
Plasmid#169930PurposeOverexpression of 1-270AA CycK-GFP fusionDepositorAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-EGFP-Frame0-Parental-Minicircle
Plasmid#216124PurposeParental minicircle containing EGFP flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the EGFP tag as a synthetic exon into frame 0 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-EGFP-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Positron2-ST-WPRE
Plasmid#239080PurposeAAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequenceDepositorInsertPositron2-ST
UseAAV and Cre/LoxTagssoma localization targeting sequenceExpressionMammalianMutationR78K N81D D92N W178FPromoterhSynapsin1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
PP_070_pAAV_CAG_LR-Voltron2-P2A-LR-CheRiff-TS-eYFP-ER2
Plasmid#203228PurposeCo-expressing membrane-localized Voltron2 and membrane-localized CheRiff.DepositorInsertMembrane-localized optopatch for neuronal dendrites
UseAAVExpressionMammalianPromoterCAGAvailable SinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-intron2-Venus-NLS-D2
Plasmid#110057PurposePer2 transcription fluorescence reporterDepositorInsertPer2 promoter and Venus (Per2 Mouse)
UseAAV and Cre/LoxTagsNLS-D2ExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only