We narrowed to 895 results for: gcat
-
Plasmid#100715PurposeB52 plasmid expressing SMARCAL1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SMARCAL1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pOsU3-esgRNA
Plasmid#115629Purposeexpression esgRNA in rice protoplastsDepositorInsertOsU3p-esgRNA
UseCRISPRAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_EPHA2
Plasmid#183286PurposeAll-in-One CRISPRko system with a guide RNA that targets EPHA2 geneDepositorInsertEPHA2
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH183
Plasmid#122856PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate D-E flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorAvailable SinceJune 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_3
Plasmid#36370DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
PX459-CDKN1A
Plasmid#217457PurposeFor CDKN1A (p21) knockoutDepositorInsertCRISPR Cas9 guide for CDKN1A
UseCRISPRExpressionMammalianAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-PDS3_IMS
Plasmid#112875Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting PDS3
UseCRISPRExpressionPlantAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Hygro-sgSIK3
Plasmid#138699PurposeExpresses a human SIK3-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
CAG-EGFP-Otx2shRNA1
Plasmid#73981PurposeOtx2 shRNA1 (mir155 backbone) was inserted into the 3'UTR of EGFP.DepositorInsertshRNA that targets the mouse Otx2 gene
ExpressionMammalianPromoterCAGAvailable SinceMay 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_BB_2A-GFP_MAPRE1-gRNA#1
Plasmid#107726PurposeKnock out of EB1 in human cells by CRISPR/Cas9DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV CMV-DIO-(mCherry-U6)-shRNA(anti-Crh)
Plasmid#214732PurposeExpresses shRNA against CRH, marked with mCherry, in infected and cre positive cellsDepositorInsertanti-Crh shRNA / mCherry
UseAAVAvailable SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
YN2_1_IL50_HOlocus
Plasmid#194426PurposeExpresses Cas9 and sgRNA cassettes for targeting the HO locus in yeast Saccharomyces cerevisiaeDepositorInsertCas9
ExpressionYeastMutationNAAvailable SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-1
Plasmid#180391PurposeProducing AAV that encodes mouse Stk16 shRNA-1 with miR-E backboneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRIN-E-shREN
Plasmid#105585PurposeDox-inducible mirE shREN(control shRNA)/dsRED expression with Venus marker and Neo resistanceDepositorInsertcontrol shRNA targeting luciferase
UseRNAi and RetroviralExpressionMammalianPromoterTREAvailable SinceMarch 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only