We narrowed to 7,278 results for: cas9 plasmid
-
Viral Prep#73179-LVPurposeReady-to-use Lentiviral Prep particles produced from Human sgRNA library Brunello in lentiCRISPRv2 (#73179). In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2 plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR screening in human cells. This backbone contains SpCas9 and unique gRNAs, and can be used to make edits across 19,114 genes in the human genome. In addition to the viral particles, you will also receive purified Human sgRNA library Brunello in lentiCRISPRv2.DepositorAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only
-
Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (Lentiviral Prep)
Viral Prep#92379-LVPurposeReady-to-use Lentiviral Prep particles produced from Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A (#92379). In addition to the viral particles, you will also receive purified Human CRISPRa sgRNA library Calabrese in backbone XPR_502 (P65 HSF), Set A plasmid DNA. Ready-to-use lentiviral pooled library for CRISPR activation screening in human cells. Contains 56,762 sgRNAs, targeting 18,885 genes. Concentrated lentiviral particles carrying set A of the Calabrese human CRISPRa sgRNA activation library in backbone XPR_502 (P65 HSF) .DepositorAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMS59
Plasmid#215680PurposeCas9 + guide plasmid targeting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEcgRNA
Plasmid#166581PurposeCRISPR-Cas9-assisted genome editing in Escherichia coliDepositorInsertccdB
ExpressionBacterialAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pVT36b
Plasmid#184437PurposeCRISPR/Cas9 plasmid, containing ScARS, IoURA3, iCas9, RPR1’-tRNA_Leu promoter, and sgRNA scaffoldDepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceMay 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRGEB33
Plasmid#158151PurposeConstruction of inPTG-Cas9 plasmids expressing gRNA within an engineered intron for binary vector plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYZ033
Plasmid#98404PurposeEntry vector for S. pombe CRISPR-Cas9 system. The gRNA can be integrated easily through Gibson Assembly with the plasmid backbone digested by Not1DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYZ173
Plasmid#98410PurposeCas9-gRNA lys9 plasmid for lys9 deletion in S. pombeDepositorInsertgRNA targeting Sp.lys9 (SPBC3B8.03 Fission Yeast)
UseCRISPRAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBLO1808_arC9_2xNLS_human
Plasmid#74491PurposeHuman codon optimized plasmid to express arC9 t2a mCherry w/2xNLS and a sgRNADepositorInsertarC9
Tagst2a mCherryExpressionMammalianAvailable SinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
-
pAEF5
Plasmid#136305PurposePlasmid encoding the Cas9 gene and a gRNA expression cassette allowing to clone a single or multiple gRNAs for DSBs induction in yeast. Constructed by Aubin FleissDepositorTypeEmpty backboneUseCRISPRAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRGEB34
Plasmid#158152PurposeConstruction of inPTG-Cas9 plasmids with a truncated 5'-UTR intron for plant genome editingDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceNov. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-TREX2-N
Plasmid#244022PurposeGateway entry plasmid (attL1& attR5) expressing TREX2 exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsTREX2Available SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ166-AtEXO1B-N
Plasmid#244023PurposeGateway entry plasmid (attL1& attR5) expressing AtEXO1B exonuclease fused to the N-terminus of zSpCas9, connected by a flexible XTEN linker, without promoterDepositorInsertCas9
UseCRISPRTagsAtEXO1BAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
FD1
Bacterial Strain#125258PurposeDerivative of MG1655 used for the screening of clones able to survive the bad seed toxicity of dCas9, while still efficiently silencing the expression of mcherryDepositorBacterial ResistanceNoneAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBTK601
Plasmid#110607PurposeBTK assembled plasmid - encodes Cas9 with no targeting sgRNA (used with suicide plasmid for broad-host-range genome alteration)DepositorInsertCas9
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPTG-GG-sg2+sg3
Plasmid#127199PurposePlasmid expressing sgRNA2 (TACCACATTTGTAGAGGTT) & sgRNA3 (CAATGTATCTTATCATGTC) as polycistronic tRNA-gRNA from single U6 promoterDepositorInserttRNA-gRNA
UseEmpty sgrna plasmidExpressionMammalianPromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTJK459
Plasmid#138008PurposeEmpty sgRNA expression vector for expression of sgRNA for Sp Cas9DepositorTypeEmpty backboneUseLentiviralMutationU-A flip and hairpin extension: cgtttAagagctaTGCT…Available SinceMay 18, 2020AvailabilityAcademic Institutions and Nonprofits only