We narrowed to 14,352 results for: Cas9
-
Plasmid#92112PurposeExpression plasmid for human codon-optimized dead/inactive SpCas9 (without U6-sgRNA coding sequence)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdead/inactive SpCas9
UseCRISPRTagsHA tag and NLSExpressionMammalianMutationD10A, H840APromoterCbhAvailable sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available sinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLKO.1-puro U6 sgRNA CAG
Plasmid#50927PurposeU6 driven sgRNA negative controlDepositorInsertnegative control sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAVS1 gRNAs-Cas9D10A-mRuby
Plasmid#252799PurposePlasmid for paired targeting of AAVS1 locus via Cas9(D10A)nickaseDepositorInsertCas9(D10A)
TagsmRubyExpressionMammalianAvailable sinceMarch 24, 2026AvailabilityAcademic Institutions and Nonprofits only -
dead Sa Cas9
Plasmid#138162PurposeFor orthogonal R loop assay (use with Sp-derived base editor, Sp gRNA, and Sa gRNA for assay)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdSaCas9
TagsNLSExpressionMammalianMutationD10A + N580APromoterCMVAvailable sinceFeb. 19, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TetO-dCas9-D3A
Plasmid#78254PurposeExpresses dead Cas9 (dCas9) fused to DNMT3A catalytic domain (CD) linked to IRES-mCherry under the control of TetOp and a minimal CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertDNMT3A CD aa 598-912 (DNMT3A Human)
UseCRISPRTagsFlag epitope tagExpressionMammalianPromoterCMVAvailable sinceAug. 2, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTE_20 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-BARD1-NLS-HbaUTR
Plasmid#252016PurposeIn vitro transcription of Cas9-BARD1 TruEditor for mRNA generationDepositorPublicationInsertCas9-BARD1
UseCRISPRExpressionMammalianMutationNAAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_22 - pIVT_CMV-synUTR-inactT7-NLS-Cas9-NLS-XTEN-SLX1A-NLS-HbaUTR
Plasmid#252018PurposeIn vitro transcription of Cas9-SLX1A TruEditor for mRNA generationDepositorPublicationInsertCas9-SLX1A
UseCRISPRExpressionMammalianMutationNAAvailable sinceMarch 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_03 - pLenti_EFS-Cas9-XTEN-BARD1-2A-BlastR
Plasmid#251999PurposeLentiviral mammalian expression of Cas9-BARD1 TruEditorDepositorPublicationInsertCas9-BARD1
UseCRISPR and LentiviralMutationNAAvailable sinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTE_01 - pLenti_EFS-Cas9-XTEN-ZRANB3-2A-BlastR
Plasmid#251997PurposeLentiviral mammalian expression of Cas9-ZRANB3 TruEditorDepositorPublicationInsertCas9-ZRANB3
UseCRISPR and LentiviralMutationNAAvailable sinceMarch 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
PV521
Plasmid#132346PurposeCas9 R promoter targeting sgRNA1 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA1
ExpressionPlantAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PV523
Plasmid#132347PurposeCas9 R promoter targeting sgRNA2 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA2
ExpressionPlantAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PV528
Plasmid#132348PurposeCas9 R promoter targeting sgRNA3 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA3
ExpressionPlantAvailable sinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCAG-CBE4max-SpRYc-P2A-EGFP
Plasmid#208336PurposeCAG promoter expression plasmid for human codon optimized BE4max C-to-T base editor with SpRYcDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman codon optimized CBE4max Cas9 variant named SpRYc with P2A-EGFP
UseCRISPRTagsP2A-EGFPExpressionMammalianMutationSc++ (1-1119), SpRY (1111-1368), D10APromoterCAGAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9C
Plasmid#80931PurposeExpresses Cas9C in mammalian cells.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable sinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTLR repair vector
Plasmid#64322PurposeVector for repair of the traffic light reporter (TLR), providing the venus coding regionDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertVenus
UseArtificial targeting vectorMutationsee publication for detailsPromoternoneAvailable sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCN-EF2132tet
Plasmid#107191PurposeExpresses EF2132 recombinase for performing recombineering in S. aureusDepositorInsertsEF2132
tetR
ExpressionBacterialPromoterp23Available sinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSA127 A2UCOE-Cas9-BFP
Plasmid#249151PurposeOverexpression of SpCas9-BFP and blasticidin resistance gene. Contains minimal A2UCOE and Cp36 recombination site.DepositorInsertA2UCOE-Cas9-TagBFP
UseCRISPR; Cp36 donor dnaExpressionMammalianPromoterEF1aAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only