We narrowed to 7,149 results for: cas9 plasmid
-
Viral Prep#112677-AAV9PurposeReady-to-use AAV9 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV1)
Viral Prep#112677-AAV1PurposeReady-to-use AAV1 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2)
Viral Prep#112677-AAV2PurposeReady-to-use AAV2 particles produced from pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (#112677). In addition to the viral particles, you will also receive purified pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP plasmid DNA. EF1a-driven, Cre-dependent color switch. This AAV directs expression of nuclear mCherry in the absence of Cre. In the presence of Cre, nuclear EGFP (and not mCherry) will be expressed. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-negative cells), EGFP (Cre-positive cells)Available SinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK1520
Plasmid#65777PurposeHuman expression plasmid for SpCas9 sgRNA (need to clone in spacer into BsmBI sites): U6-BsmBIcassette-Sp-sgRNADepositorInsertSpCas9 gRNA backbone, without spacer sequence
UseCRISPRExpressionMammalianPromoterU6Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pPtGE35
Plasmid#107999PurposeExpresses TevCas9 in Phaeodactylum tricornutum / Encodes elements required for conjugationDepositorInsertsOriT
40SRPS8 Promoter
ShBle
40SRPS8 Terminator
Cen6-ArsH4-His3
I-TevI nuclease and partial linker domain
UseCRISPR and Synthetic Biology; Episomal vector for…TagsCas9Available SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNM220_AAVS1 integration helper
Plasmid#211864PurposeCas9 cutting at AAVS1 safe harbor locusDepositorInsertAAVS1
UseCRISPRMutationN/AAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP1101
Plasmid#65773PurposeHuman expression vector for SpCas9 VRER variant: CMV-T7-humanSpCas9(D1135V/G1218R/R1335E/T1337R)-NLS-3xFLAG (VRER variant)DepositorInsertmammalian codon-optimized Streptococcus pyogenes Cas9 (D1135V/G1218R/R1335E/T1337R)-NLS-3XFlag
UseCRISPRTags3x FLAG and NLSExpressionMammalianMutationD1135V, G1218R, R1335E, and T1337R mutations in C…PromoterCMV & T7Available SinceJune 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-B2UP49_GFP
Plasmid#103071PurposeCas9 coding gene template with optimized sequence for human codon usage, also expresses EGFPDepositorInsertB2UP49(Cas9 coding gene from Akkermansia muciniphila (strain ATCC BAA-835))
UseCRISPRExpressionMammalianMutationhuman codon-optimizedPromoterCMVAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMLS287
Plasmid#73730PurposeSapTrap flexible linker C-terminal connector donor plasmidDepositorInsertFlexible Linker
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS288
Plasmid#73735PurposeSapTrap flexible linker N-terminal connector donor plasmidDepositorInsertFlexible Linker
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS279
Plasmid#73729PurposeSapTrap FLP-on C-terminal connector donor plasmidDepositorInsertC-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS382
Plasmid#73731PurposeSapTrap Flagtag-TEV C-terminal connector donor plasmidDepositorInsertFLAGtag-TEV
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS282
Plasmid#73733PurposeSapTrap FLP-on N-terminal connector donor plasmidDepositorInsertN-terminal FLP-on
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMLS383
Plasmid#73736PurposeSapTrap TEV-Flagtag N-terminal connector donor plasmidDepositorInsertTEV-FLAGtag
UseCRISPRAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS2-3xFLAG-2xNLS
Plasmid#107303PurposeExpresses ZFP-VEGFA-TS2 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS2
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSD_2xNES-FRB-ZFPTS3-3xFLAG-2xNLS
Plasmid#107304PurposeExpresses ZFP-VEGFA-TS3 fused to FRB in mammalian cellsDepositorInsertZFP_VEGFA-TS3
UseCRISPRTags2xNES, 3x Flag, 2xNLS, and FRBExpressionMammalianPromoterCMV IE94Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC gRNA Shuttle
Plasmid#47024PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.DepositorInsertgRNA Shuttle
UseCRISPR; Cas9ExpressionPlantMutationG to T cloning mutation at position 323PromoterMedicago truncatula U6.6Available SinceSept. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits