We narrowed to 6,190 results for: ARL
-
Plasmid#193558PurposeExpresses mTurquoise2-mScarlet-I in mammalian cells.DepositorInsertmTurquoise2-mScarlet-I
ExpressionMammalianAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn_CapChR1_mScarlet
Plasmid#188037PurposeExpresses CapChR1-mScarlet in mammalian neuronsDepositorInsertCapChR1-mScarlet
UseAAVTagsmScarletMutationS63D, L132C, T159C and N258E mutations in CrChR2PromoterhSynAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIN3_enpp-1_mScarlet
Plasmid#182934PurposeExpresses enpp-1 (C27A7.1) under its native promoter (male reproductive tract and ciliated neurons IL2, CEMs, HOB, RnBs in C. elegans)DepositorInsertgenomic enpp-1 fused to mScarlet
Tagsflexible linker (GGGGS)x3 and mScarlet tagExpressionWormPromoterenpp-1Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMT335-mScarletI
Plasmid#174506PurposeHigh-copy number plasmid (pMT335) harboring the mScarletI gene for its cytoplasmic expression, inducible by vanillate (sequence of mScarletI optimized)DepositorInsertmScarletI
TagsmScarletIExpressionBacterialAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIN2_mcm-3_mScarlet
Plasmid#182933PurposeExpresses mcm-3 under its native promoter (embryonic nuclei and ciliated neurons IL2, CEMs, HOB, RnBs in C. elegans)DepositorInsertgenomic mcm-3 fused to mScarlet
Tagsflexible linker (GGGGS)x3 and mScarlet tagExpressionWormPromotermcm-3Available SinceAug. 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
RPL13A_PQR_mScarlet_NOL_LoxP_PQR_zeo_PQR_MCS_RPL13A-3'UTR
Plasmid#165043PurposeRepair template for CAS9 complex genome editingDepositorInsertRPL13A (RPL13A Human)
ExpressionBacterialAvailable SinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
68Q-ymScarlet
Plasmid#128562PurposeHttex1 (without proline-rich region) fused to ymScarletDepositorInsert68Q-Httex1 (without proline-rich region) fused to ymSarlet
TagsymScarletExpressionYeastPromoterGal1Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
25Q-ymScarlet
Plasmid#128561PurposeHttex1 (without proline-rich region) fused to ymScarletDepositorInsert25Q-Httex1 (without proline-rich region) fused to ymSarlet
TagsymScarletExpressionYeastPromoterGAL1Available SinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shARL4C.1
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Homo sapiens, Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL2
Plasmid#67459PurposeMammalian expression of hArl2 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4
Plasmid#67461PurposeMammalian expression of hArl4 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL5A
Plasmid#67462PurposeMammalian expression of hArl5 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL5B
Plasmid#67463PurposeMammalian expression of hArl5b with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL6
Plasmid#67464PurposeMammalian expression of hArl6 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL4D
Plasmid#67468PurposeMammalian expression of hArl4D with stop codon (native expression)DepositorInsertARL4D (ARL4D Human)
ExpressionMammalianMutationbp 272 A to C; N91T mutation; bp 327 T to G; sil…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL14
Plasmid#67469PurposeMammalian expression of hArl14 with stop codon (native expression)DepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-ARL11
Plasmid#67470PurposeMammalian expression of hArl11 with stop codon (native expression)DepositorInsertARL11 (ARL11 Human)
ExpressionMammalianMutationbp 261 G to A; silent mutation; bp 442 T to C; aa…PromoterCMVAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL6
Plasmid#67380PurposeExpression of native hArl6 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL4C
Plasmid#67381PurposeExpression of native hArl4c in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL8A
Plasmid#67382PurposeExpression of native hArl8 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL4D
Plasmid#67384PurposeExpression of native hArl4D in E. coliDepositorInsertARL4D (ARL4D Human)
ExpressionBacterialMutationbp 272 A to C; N91T mutation; bp 327 T to G; sil…PromoterT7Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL14
Plasmid#67385PurposeExpression of native hArl14 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL11
Plasmid#67386PurposeExpression of native hArl11 in E. coliDepositorInsertARL11 (ARL11 Human)
ExpressionBacterialMutationbp 261 G to A; silent mutation; bp 442 T to C; aa…PromoterT7Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL1
Plasmid#67374PurposeExpression of native hArl1 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL2
Plasmid#67375PurposeExpression of native hArl2 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL4
Plasmid#67377PurposeExpression of native hArl4 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDEST14-ARL5A
Plasmid#67378PurposeExpression of native hArl5 in E. coliDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARL5A
Plasmid#67324PurposehArl5a with stop codon in Gateway Entry vectorDepositorInsertARL5A (ARL5A Human)
UseGateway entry vectorExpressionBacterialMutationbp 70 C to T; silent mutationPromoterNoneAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARL5B
Plasmid#67326PurposehArl5b with stop codon in Gateway Entry vectorDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ARL6
Plasmid#67328PurposehArl6 with stop codon in Gateway Entry vectorDepositorAvailable SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only