We narrowed to 6,648 results for: tac
-
Plasmid#127250PurposeExpresses the Dominant Negative CstF64 in mammalian cells; DN blocks polyadenylationDepositorInsertCstF64 delta 282 (CSTF2 Human)
UseOtherTagsExpressionMammalianMutationinsert @SanD1:GTCCAGGCGCCTACCCATACGACGTCCCAGACTAC…PromoterpEF1aAvailable sinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC946 - pAAV CMV-IE NK1R-IRES-EGFP
Plasmid#102935PurposeAn AAV vector that expresses rat NK1R-IRES-EGFP under the CMV-IE promoterDepositorInsertNK1R (Tacr1 Rat)
UseAAVTagsExpressionMammalianMutationPromoterCMV-IEAvailable sinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLC-RFP657-CASP8
Plasmid#75164PurposeLentiCRISPR-RFP657 with sgRNA targeting human Caspase-8DepositorInsertCASP8 sgRNA (CASP8 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUDE710
Plasmid#103020Purposeexpression of a Cpf1 programming crRNA targeting ADE2 and HIS4 (crADE2-3 crHIS4-4.S)DepositorUseCRISPRTagsExpressionYeastMutationPromoterSNR52Available sinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-A2UCOE-EF1a-iCasp9-P2A-HLA-E SCT-T2A-hCD55-E2A-neo-AAVS1
Plasmid#205444Purposehuman AAVS1-targeting plasmid for expression of human CD46, HLA-G SCT, CD47, and CD59DepositorInsertiCasp9-HLA-E SCT-hCD55
UseTagsExpressionMammalianMutationPromoterEF1aAvailable sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLAP-BUBR1-dKARD
Plasmid#114053Purposetransfection in mammalian cells, combination of fluorescent protein fusion and tandem affinity purificationDepositorInsertBUBR1-dKARD (BUB1B Human)
UseTagsYFP-TEV-S- Human LAPExpressionMammalianMutationC2823A and G2826A (siRNA-resistance): AGATACTAGCT…PromoterAvailable sinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_3
Plasmid#155071PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_MDM4_exon_deletion_3
Plasmid#155075PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of MDM4 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cntn6-AP-His
Plasmid#71944PurposeExpresses the extracellular region of the Contactin 6 protein (truncated immediately upstream of propeptide cleavage and GPI-attachement site), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorInsertCntn6 (Cntn6 Mouse)
UseTagsAP-HisExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROR2 gRNA (BRDN0001146490)
Plasmid#77940Purpose3rd generation lentiviral gRNA plasmid targeting human ROR2DepositorInsertROR2 (ROR2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-12mer-14kb-USF-1-12
Plasmid#227472Purpose12-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 14kb Upstream Fgf5
UseCRISPRTagsExpressionMutationPromoterAvailable sinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO-Zc3h12a 3’UTR
Plasmid#222662PurposeLuciferase reporter vector containing mouse Zc3h12a 3'UTRDepositorInsertZc3h12a 3'UTR (Zc3h12a Mouse)
UseLuciferaseTagsExpressionMammalianMutationPromoterPGKAvailable sinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-547 aa
Plasmid#222657PurposeMammalian expression vector to express 1-547 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-547 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated histidine 548 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-409 aa
Plasmid#222658PurposeMammalian expression vector to express 1-409 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-409 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated proline 410 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-FLAG-Regnase-3_1-244 aa
Plasmid#222659PurposeMammalian expression vector to express 1-244 aa of Regnase-3 tagged with FLAG at N-termDepositorInsertZc3h12c 1-244 aa (Zc3h12c Mouse)
UseTagsFLAGExpressionMammalianMutationmutated asparagine 245 to a stop codonPromoterCMVAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-Regnase-3 WT-T2A-copGFP
Plasmid#222660PurposeLentiviral vector to express mouse Regnase-3 WTDepositorInsertZc3h12c (Zc3h12c Mouse)
UseLentiviralTagsExpressionMammalianMutationmutated stop codon prior to a T2A peptidePromoterEF1αAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-Regnase-1 D141N
Plasmid#222654PurposeMammalian expression vector to express mouse Regnase-1 D141N mutantDepositorInsertZc3h12a (Zc3h12a Mouse)
UseTagsExpressionMammalianMutationmutated aspartic acid 141 to asparagine to abroga…PromoterCMVAvailable sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-FLAG-HA-Regnase-3 D252N
Plasmid#222652PurposeFor in vitro transcription of mouse Zc3h12c D252N mutant tagged with FLAG-HA at N-termDepositorInsertZc3h12c (Zc3h12c Mouse)
UseIn vitro transcriptionTagsFLAG and HAExpressionMutationmutated aspartic acid 252 to asparagine to abroga…PromoterT7Available sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC57 mini-ZsGreen-P2A-FLAG-HA-Regnase-1 WT
Plasmid#222649PurposeFor in vitro transcription of mouse Zc3h12a tagged with FLAG-HA at N-termDepositorInsertZc3h12a (Zc3h12a Mouse)
UseIn vitro transcriptionTagsFLAG and HAExpressionMutationPromoterT7Available sinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_SFRS7_exon_deletion_4
Plasmid#155072PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of SFRS7 exon using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only