We narrowed to 7,645 results for: Ski;
-
Plasmid#120714PurposeExpresses membrane-targeted recruiter protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsFKBP and mCherryExpressionMammalianMutationamino acids 158-188PromoterCMVAvailable SinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLE1 N-ISCmut
Plasmid#160803PurposeExpress N-terminal ISC mutant POLE1DepositorInsertPOLE1 N-ISCmut (POLE Human)
UseRetroviralTags3xFLAGExpressionMutationshPOLE_1 and shPOLE2 resistant, C651S, C654S, C66…PromoterAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA1
Plasmid#201594PurposeCRISPR/Cas9-mediated gene knock-outDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP310-pAAV-Mecp2P-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113687PurposeSaCas9 driven by the neuron specific promoter Mecp2P. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP311-pAAV-EFS-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113688PurposeSaCas9 driven by EFS. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACS.DepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1CAN-HA
Plasmid#178030PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLE1 C-ISCmut
Plasmid#160804PurposeExpress C-terminal ISC mutant POLE1DepositorInsertPOLE1 C-ISCmut (POLE Human)
UseRetroviralTags3xFLAGExpressionMutationshPOLE_1 and shPOLE2 resistant, C2221S, C2224S, C…PromoterAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP312-pAAV-CMV-SaCas9-P2A-HAFLAGHA-KASH-pA
Plasmid#113689PurposeSaCas9 driven by CMV. SaCas9 is followed by the self cleaving P2A sequence, several tags, and then the KASH transmembrane domain to enable FACSDepositorInsertSaCas9 (NEWENTRY )
UseAAV and CRISPRTagsFlag, HAx2, KASH, and NLSExpressionMutationPromoterCytomegalo Virus(CMV)Available SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P5-6A
Plasmid#51249PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 980,1006 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 980,1006 mutated to AlaPromoterEF1aAvailable SinceFeb. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQC MCS IRES G418
Plasmid#110344Purposeγ-Retroviral transfer vector for cloning and expressing your gene of interest. IRES-driven Geneticin selection.DepositorTypeEmpty backboneUseRetroviralTagsExpressionMammalianMutationPromoterCMVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5/FRT/DEST-3xHA/mGli3/Flag P1-4A
Plasmid#51247PurposeEncodes N-3xHA-TEV-mouseGli3-Flag-C; amino acids 849,865,877,907 mutated to AlaDepositorInsertGli3 (Gli3 Mouse)
UseFlpin systemTags3xHA-TEV and FlagExpressionMammalianMutationamino acids 849,865,877,907 mutated to AlaPromoterEF1aAvailable SinceFeb. 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast POLD1 ISCmut
Plasmid#160806PurposeExpress ISC mutant POLD1DepositorInsertPOLD1 ISCmut (POLD1 Human)
UseRetroviralTagsExpressionMutationCodon optimized C-terminal 230 amino acids, C1058…PromoterAvailable SinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
PAX3::FOXO1-2A-sfGFP
Plasmid#240098Purposehuman PAX3::FOXO1 in -2A-sfGFP backbone (Plasmid# 74668)DepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCW-TAZ-CAMTA1
Plasmid#235681PurposeExpress TAZ-CAMTA1 fusion gene in mammalian cells using the doxycycline-inducible TRE promoterDepositorUseLentiviralTagsFLAGExpressionMammalianMutationPromoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-hfCas13d-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233046PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged hfCas13d and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and hfCas13d and mCherry
UseTagsmCherryExpressionMammalianMutationPromoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAK-DR30(SapI)-CasRx-Puro-pA/EF1A-mCherry-WPRE-pA
Plasmid#233045PurposeTo express a RfxCas13d-compatible gRNA and to express HA Tagged CasRx and a Puro resistance gene. It also encodes an mCherry gene. The CasRx and Puro coding regions are separated by a T2A site.DepositorInsertRfxCas13d-compatible gRNA expression cassette and CasRx and mCherry
UseTagsmCherryExpressionMammalianMutationPromoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-GPI_sgRNA2
Plasmid#201595PurposeCRISPR/Cas9-mediated gene knock-outDepositorAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-MIR302-3g-EEA-2g-PGK-Puro
Plasmid#201677PurposeEBNA episome plasmid for U6 promoter-driven expression of 3 gRNAs targeting miRNA302/367 (Addgene #201960) and 2 gRNAs targeting EEA-motif (Addgene #102898). Includes PGK-puro selection cassetteDepositorInsertMIR302-3g-EEA-2g-PGK-Puro
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJune 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCV Cdk2ap1ΔN (MT2B2)-HA
Plasmid#178031PurposeRetroviral vector for the purpose of overexpression in mammalian cell cultureDepositorInsertCdk2ap1 (Cdk2ap1 Mouse)
UseRetroviralTagsHAExpressionMammalianMutationFirst N-Terminal 27aa are deletedPromoterGAGAvailable SinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-EGFP MASTL E167D (siRNA resistant)
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
UseTagsEGFPExpressionMammalianMutationE167DPromoterAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only