32,812 results
-
Plasmid#159047PurposeT7 expression of C-term fluorescent fusion in E. coliDepositorInsertMSMEG_0250
UseIntegrating mycobacterial expression vector attl5TagsGly-Ala Linker/Dendra2/1x Flag TagExpressionBacterialPromoterpmycTetOAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPSU60
Plasmid#173833PurposeExpresses 60 kD Penn State ladder proteinDepositorInsertHSTPABPACRCC1
ExpressionBacterialPromoterT7Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pALACE
Plasmid#31853DepositorTypeEmpty backboneUseEscherichia coli-mycobacterium shuttle plasmidTags6xHISExpressionBacterialPromoterAcetamidase operoneAvailable SinceJuly 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMMB67EH-dddAI
Plasmid#186559PurposeBroad host range regulated expression of the DddA immunity determinant (DddAI)DepositorInsertdddAI
ExpressionBacterialPromotertacAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcI-ts,ind+-(NSP8)
Plasmid#160656PurposeExpresses codon optimized SARS-CoV-2 NSP8 in E. coliDepositorInsertSARS-CoV-2 NSP8 (ORF1ab Synthetic)
ExpressionBacterialAvailable SinceDec. 10, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLG020 (AVAST type 4)
Plasmid#157898PurposeExpresses the AVAST type 4 defense systemDepositorInsertAVAST type 4 (STAND ATPase with Mrr-like N-terminal domain)
ExpressionBacterialAvailable SinceDec. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLG019 (AVAST type 3)
Plasmid#157897PurposeExpresses the AVAST type 3 defense systemDepositorInsertAVAST type 3 (STAND ATPase with N-terminal DUF4297)
ExpressionBacterialAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPAsp-hp
Plasmid#48122PurposeShuttle vector E. coli/B.meg.; encoding the predicted optimal signal peptide for protein secretion using Bacillus megaterium under control of the xylose inducible promoterDepositorInsertpredicted optimal signal peptide for Bacillus megaterium protein secretion
UseSynthetic BiologyExpressionBacterialAvailable SinceOct. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA-G83I
Plasmid#191239PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA-G83I and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to Cysteine in SN, and Glycin…PromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSN-A112C-GpA
Plasmid#191238PurposeExpresses nuclease A-H124L from Staphylococcus aureus, with an A112C mutation, fused through a flexible linker to the transmembrane domain of GpA and a His-tag, for fluorescent studies.DepositorInsertnuc (nuclease A), GYPA (GPA) (E(transmembrane)R)
Tagsnuclease A from S. aureus fused to the TM domain …ExpressionBacterialMutationChanged Alanine 112 to CysteinePromoterT7 promoterAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJMD14
Plasmid#138654PurposephiOZJ integrating Streptomyces expression vector, intact RDFDepositorTypeEmpty backboneExpressionBacterialPromoterPermE* variant sequence from pDA1652Available SinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQLinkGD
Plasmid#13673DepositorInsertGateway cassette
UseCo-expressionTagsGSTExpressionBacterialAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET23a-H6-TEV-cAbl
Plasmid#214234PurposeBacterial expression of the kinase domain of cAbl with a TEV-cleavable N-terminal 6xHis affinity tag; For in vitro tyrosine phosphorylation in peptides/proteins and for kinase specificity screeningsDepositorAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
p40phox-PX (1-144)
Plasmid#119123PurposeBacterial expression of human phox homology (PX) domain, p40phox-PX (1-144)DepositorInsertp40phox-PX (1-144)
TagsGSTExpressionBacterialPromotertacAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUCSh5vio-2300
Plasmid#170987PurposeEncodes sgRNA target 2300 and Gentamicin resistance - violacein pathway transposon.DepositorInsertSh-CAST sgRNA 2300 violacein
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterplacIAvailable SinceJuly 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAurora
Plasmid#190158PurposeRegulates bacterial expression of target gene in blue-light-activated manner. Based on Nakamurella multipartita PAL.DepositorTypeEmpty backboneTagsHis6 tagExpressionBacterialAvailable SinceJan. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPING
Plasmid#26046DepositorInsertSS peptide-LacZ-KHHHHHH
TagsKHHHHHH and MGILPSPGMPALLSLVSLLSVLLMGCVAETGExpressionBacterial, Insect, and Mamm…Available SinceMay 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
SurA
Plasmid#213138PurposeExpresses chaperone SurADepositorAvailable SinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGT-Ah6
Plasmid#122573PurposeMAGIC donor plasmid (Himar transposon with catP/sfGFP payload)DepositorInsertcatP/sfGFP
UseSynthetic BiologyExpressionBacterialAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pRSF-G1(5CNW)RS
Plasmid#222872PurposetRNA synthetase/tRNA pair for the in vivo incorporation of 5-Cyano-L-Tryptophan (5-CN-Trp) into proteins in E. coli in response to the amber (TAG) codonDepositorInserttRNA synthetase
ExpressionBacterialPromoterT7Available SinceDec. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
560HTR
Plasmid#24444DepositorAvailable SinceApril 23, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUCP20T-mko1
Plasmid#78467PurposeBroad range bacterial fluorescence labelingDepositorInsertmKO1
ExpressionBacterialAvailable SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
Reb_79 aka PAS620
Plasmid#71225PurposeReb_1 with RebA(Q91R)DepositorInsertReb locus
TagsnoneExpressionBacterialMutationRebA( G53A, Q91R)Available SinceApril 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV4Neo-murine IL-17RA-HA
Plasmid#46859Purposeexpresses mouse IL-17RADepositorAvailable SinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS1
Plasmid#140624PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS1. The crRNA-IS1 targets IS1 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS1
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T2-Rheb
Plasmid#15889DepositorAvailable SinceOct. 26, 2007AvailabilityAcademic Institutions and Nonprofits only -
SiriusGFP
Plasmid#123201PurposeWe have developed a variant of eGFP, SiriusGFP, that shows over a two fold increase in photostability with utility in methods requiring sustained or high intensity excitation as in 4D confocal or SIM.DepositorInsertSiriusGFP
UseMouse TargetingTagsN/AExpressionBacterial and MammalianMutationeGFP-S30R/Y39N/F99S/N105T/S147R/M153T/V163A/S205V…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only