31,797 results
-
Plasmid#110006PurposeProtein expression and purification of DYNLL1_Dynein-lightDepositorInsertDYNLL1_Dynein-light (DYNLL1 Human)
ExpressionBacterialAvailable SinceOct. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
mem-mCherry-pTRIP
Plasmid#163521PurposeUsed to construct lentivirus to express membrane-targeted mCherry in mammalian cellsDepositorInsertmembrane targeted mCherry
UseLentiviralExpressionBacterial and MammalianAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LARS_pNIC-Bio3
Plasmid#153052PurposeExpression construct for producing Avi tagged Leucyl-tRNA synthetaseDepositorInsertLARS (LARS1 Human)
TagsAvi and His6-TEVExpressionBacterialMutationNot full length proteinPromoterT7Available SinceJune 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZP06B
Plasmid#232321PurposeMake sacB a counterselection marker to replace galKDepositorInsertPrpsJ-sacB
ExpressionBacterialAvailable SinceMarch 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPROK AdoHcyase
Plasmid#14683DepositorInsertadenosyl-homocysteine hydrolase (AHCY Human)
ExpressionBacterialAvailable SinceMay 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
IGF2BP1_2xRRM-4xKH_pGEX
Plasmid#135122PurposeRecombinant expression of IGF2BP1 with dual-affinity tagDepositorAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pT7-pelB
Plasmid#157740Purposeempty vector; N-terminal PelB signal sequence; potential C-terminal His6; T7 promoter; like pET-20b, but additionally avoids added residues in final protein since cloning uses BseRI restriction sitesDepositorTypeEmpty backboneTagsPelB signal sequence and possible His6-tag (adds …ExpressionBacterialPromoterT7Available SinceJune 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T-1-3xHA
Plasmid#129567PurposeEmpty backbone for HA tagDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJan. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZS2-123
Plasmid#26598DepositorInsertSynthetic
ExpressionBacterialMutationN/AAvailable SinceFeb. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
Twitch-2B pRSETB
Plasmid#48203PurposeFluorescent reporter for calcium signalingDepositorInsertTwitch-2B
Tags6xHIS, cpVenusCD, and mCerulean3ExpressionBacterialPromoterT7Available SinceJan. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET51b-His-TEV-SNAP-tag_fast
Plasmid#167271PurposeOverexpression of the fast variant (E30R) of SNAP-tag in E. coliDepositorInsertSNAPf-tag
TagsHis x10ExpressionBacterialMutationE30RPromoterT7Available SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-His6-SUMO-MproC145A
Plasmid#172653PurposeBacterial expression of SARS-CoV-2 Mpro C145A inactive mutant fused to SUMODepositorInsertSARS-CoV-2 Mpro (ORF1ab Severe acute respiratory syndrome coronavirus 2)
Tags6xHis Tag and SUMOExpressionBacterialMutationCatalytic Cysteine 145 mutated to AlaninePromoterT7Available SinceAug. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK2101
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 p37
Plasmid#169015PurposeExpresses GST-p37 (human, codon optimized for expression in bacteria)DepositorInsertp37 (UBXN2B Human)
TagsGSTExpressionBacterialMutationsequence was codon optimized for expression in E.…PromotertacAvailable SinceJune 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSR1154
Plasmid#221653PurposeTetracycline sensor v3 for Staphylococcus aureusDepositorInsertssfGFP cassette
TetR cassette
UseSynthetic BiologyExpressionBacterialPromoterPXyl-TetO and PZwfAvailable SinceMarch 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRM919_WT aa 1-419 His POLI
Plasmid#201445PurposeLow copy vector for expressing the catalytic domain (amino acids 1-419) of human DNA polymerase iota in E. coli with an N-terminal 6x His tag. C-terminal truncation mutant of pJRM919_WT His POLIDepositorInsertDNA polymerase iota (POLI Human)
Tags6x HisExpressionBacterialMutationExpresses amino acids 1-449 of DNA polymerase iot…Available SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET41a iGluu
Plasmid#119834PurposeProduction of recombinant iGluSnFR S72T ultrafast variant, a single-wavelength glutamate indicator, in E. coliDepositorInsertiGluu
TagsGSTExpressionBacterialMutationS72TPromoterT7Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pL0M-S-mTurquoise2-EC18152
Plasmid#137074PurposeGolden Gate Level 0 S module for N-terminal fluorescent protein taggingDepositorInsertmTurquoise2 DNA synthesis product with 5' and 3' extensions for Golden Gate cloning
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJL33
Plasmid#227430PurposeKanamycin resistant L5-integrative vector for CRISPR interference in M.tuberculosis with the constitutive expression of mWasabi under the control of the psmyc promotor (psmyc::mWasabi)DepositorInsertmWasabi
UseCRISPRExpressionBacterialAvailable SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only