30,535 results
-
Plasmid#25626DepositorInsertJC Virus Mad-1
UseTagsExpressionBacterialMutationPromoterAvailable SinceOct. 20, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCDF-1b-RFC140ΔN555
Plasmid#175043PurposeOverexpression of human (Rfc1) p140ΔN555 in E.coliDepositorInsertReplication factor C subunit 1 (RFC1 Human)
UseTagsExpressionBacterialMutationPromoterT7 promoterAvailable SinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
UAS:hGCG-ICAM(1235)- Nrxn1b;cryaa:mCherry
Plasmid#218860Purpose10xUAS promoter driving expression of human glucagon-truncated ICAM-zfNrxn1b fusion protein for use in trans-Tango.DepositorInserthGCG-ICAM(1235)-nrxn1b
UseTagsExpressionBacterialMutationPromoterAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAmCyan1-C1-ADCY6
Plasmid#113905PurposeN-terminal Cyan Fluorescent tag in Adenylate Cyclase 6DepositorInsertAdenylate Cyclase 6 (ADCY6 Human)
UseTagsCyanExpressionBacterial and MammalianMutationPromoterpCMVAvailable SinceOct. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
1a. pETM11-SUMO-SNCA-GFP
Plasmid#107292PurposePlasmid for the expression of the construct alpha-Synuclein-GFP, which contains N-terminal tags, which can be cleaved later: His-tag for purification and SUMO-tag for better solubilityDepositorInsertSNCA-GFP (SNCA Human)
UseTagsHis-tag and SUMO-tagExpressionBacterialMutationPromoterT7Available SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-OTUD6B (full-length, aa 1-293)
Plasmid#61418PurposeExpresses human OTUD6B (full-length) in E. coli.DepositorAvailable SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
SRPK1 (SRPK1A-c100)
Plasmid#98246PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBad-LgBiT-PhoCl1-SmBiT-MBP
Plasmid#164034Purposeluciferase-based PhoCl screening constructDepositorInsertLgBiT-PhoCl1-SmBiT-MBP
UseTagsHis tag, T7 tag, Xpress TagExpressionBacterialMutationPromoteraraBad promotorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)
Plasmid#128164PurposeUV5 promoter drives expression of Zif268-consensus peptide fusion. Pair with pGHUC w-ERBIN as a positive control (turns on HIS3/GFP).DepositorInsert10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
UseSynthetic BiologyTagsFLAG and zif268ExpressionBacterialMutationPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET11a+CYP119
Plasmid#66131PurposeExpresses the wild type of CYP119DepositorAvailable SinceJune 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGHUC w-ERBIN (2-hybrid prey plasmid)
Plasmid#128163PurposeUV5 promoter drives expression of omega-erbin fusion. Pair with pB1H2 UV5 Zif268-cons as a positive control (turns on HIS3/GFP).DepositorInsertERBIN PDZ domain (ERBIN Synthetic)
UseSynthetic BiologyTagsFLAG and Omega subunit of RNA polymeraseExpressionBacterialMutationPromoterUV5Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
p36-p37-p38-p40-pET-Duet-1
Plasmid#175049PurposeOverexpression of human Rfc2,Rfc3,Rfc4,Rfc5 in E.coliDepositorUseTagsExpressionBacterialMutationPromoterT7 promoterAvailable SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLysscys255
Plasmid#36429DepositorInsertSaporin-3/cys255
UseTagsExpressionBacterialMutationcys added at position 255PromoterT7Available SinceMay 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b
Plasmid#89898PurposeBacterial expression for bzCas13b, driven by the lac promoter, and DR-spacer-DR sequence driven by js23119. New spacer sequences can be cloned in between the DRs by digesting the plasmid with BsaI.DepositorInsertCas13b
UseTagsExpressionBacterialMutationPromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEM-3z/601
Plasmid#26656DepositorInsert
UseTagsExpressionBacterialMutationPromoterAvailable SinceNov. 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
PET30B-PTEN
Plasmid#20741DepositorAvailable SinceApril 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
6xHis-MBP-TEV-mDvl2PDZ(264-353)_pCDFduet
Plasmid#216386PurposeBacterial expression vector for MBP-tagged mouse Dvl2 PDZ domain (residues 264-353)DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
SP-Cas9
Plasmid#62731PurposeExpresses SP-Cas9 protein in bacterial cellsDepositorInsertSP-CAS9
UseCRISPRTagsHis tag and NLSExpressionBacterialMutationCodon optimazed for e.coliPromoterT7Available SinceApril 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKSJ376
Plasmid#103065PurposeExpresses colicin E1 with R domain deletion and ImmE1DepositorUseTagsExpressionBacterialMutationR (receptor-binding domain) deletion in colicin E…PromoterT7 lac (from pET) and T7 lac (from pET52-b)Available SinceDec. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only