4,958 results
-
Plasmid#245834Purposeexpresses TAPBPR-S104F-K211L-R270Q in S2 cellsDepositorInsertTAPBPR (S104F K211L R270Q) (TAPBPL Human)
TagsAviTag biotinylation tag and His6 affinity tagExpressionInsectMutationS104F K211L R270Q (HiFi mutants) & C94S (remo…PromoterMT_puroAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1829 OpIE2-Bn
Plasmid#242438PurposeInsect OpIE2 promoter expressing barnaseDepositorAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1984 UbL40-Bs
Plasmid#242439PurposeAe aegypti UbL40 promoter expressing barstarDepositorInsertBarstar
ExpressionInsectAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1983 UbL40-mCherry
Plasmid#242440PurposeAe aegypti UbL40 promoter expressing mCherryDepositorInsertmCherry
ExpressionInsectAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
AGG1767 PUb-Bs-TRE-Bn
Plasmid#242441PurposeAe aegypti PUb promoter expressing barstar, and TRE expressing barnaseDepositorInsertsBarstar
DsRED
barnase
ExpressionInsectPromoterAePUb, Hr5/IE1, and TREAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_Gateway>QF:Gal4
Plasmid#173729PurposeDrosophila QF:Gal4 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutationQF DNA binding domain, GAL4 activation domainAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_UAS>Gateway
Plasmid#173723PurposeDrosophila transgene expression under UAS/Gal4 control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutation20 x UAS sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_LexOp>Gateway
Plasmid#173724PurposeDrosophila transgene expression under LexOp/LexA control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutation13 x LexOp sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_QUAS>Gateway
Plasmid#173725PurposeDrosophila transgene expression under QUAS/QF control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutation10 x QUAS sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_Gateway>Gal4
Plasmid#173726PurposeDrosophila Gal4 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutationGal4.2Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_Gateway>LexA:QF
Plasmid#173727PurposeDrosophila LexA:QF expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutationLexA DNA binding domain, QF activation domainAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_Gateway>QF2
Plasmid#173728PurposeDrosophila QF2 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneUseGateway destination vectorExpressionInsectMutationQF2Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_UAS>MCS
Plasmid#194958PurposeDrosophila transgene expression under UAS/Gal4 control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutation20 x UAS sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_LexOp>MCS
Plasmid#194959PurposeDrosophila transgene expression under LexOp/LexA control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutation13 x LexOp sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_QUAS>MCS
Plasmid#194960PurposeDrosophila transgene expression under QUAS/QF control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutation10 x QUAS sequencesAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_MCS>Gal4
Plasmid#194961PurposeDrosophila Gal4 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutationGal4.2Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_MCS>LexA:QF
Plasmid#194962PurposeDrosophila LexA:QF expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutationLexA DNA binding domain, QF activation domainAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_MCS>QF2
Plasmid#194963PurposeDrosophila QF2 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutationQF2Available SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBID2_MCS>QF:Gal4
Plasmid#194964PurposeDrosophila QF:Gal4 expression under introduced sequence control, PhiC31 transgenesisDepositorTypeEmpty backboneExpressionInsectMutationQF DNA binding domain, GAL4 activation domainAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695_3xP3-DsRed1-SV40 (Single gRNA)
Plasmid#243009PurposeFor cloning a single gRNA after BspQI digestion under An. gambiae U6.695 promoter.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&557_3xP3-DsRed1-SV40 (Tandem 1_2 gRNAs)
Plasmid#243012PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.557 promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
AgU6.695&MosU6.syn_3xP3-DsRed1-SV40 (Tandem 2_2 gRNAs)
Plasmid#243013PurposeFor cloning two gRNAs in tandem after BspQI digestion under An. gambiae U6.695 and U6.MosU6syn (synthetic mosquito U6) promoters.DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionInsectAvailable SinceSept. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-7xsfGFP11-HA-HDR-donor
Plasmid#221818PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT7R coding frameDepositorInsert7xGFP11-HA donor with 5-HT7R homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT7R-sfGFP11-HA-CRISPR-HDR-donor
Plasmid#221819PurposeDonor plasmid for inserting GFP11-HA to the end of Drosophila 5-HT7R coding frameDepositorInsertGFP11-HA donor with homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT1BR
Plasmid#221821PurposePlasmid to express gRNA1 (gaaaatttgatttcaactga) for editing at the end of Drosophila 5-HT1BR coding frameDepositorInsertd5-HT1BR gRNA1 (5-HT1B Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT1BR
Plasmid#221822PurposePlasmid to express gRNA2 (aatttcgacgggccttcaag) for editing at the end of Drosophila 5-HT1BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformD
Plasmid#221823PurposePlasmid to express gRNA1 (tccttctggcgcaaacacgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformBFH
Plasmid#221826PurposePlasmid to express gRNA2 (ggaaaagccgctaattacag) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterDrosophila U6 promoterAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-d5-HT2BR
Plasmid#221828PurposePlasmid to express gRNA2 (aggcactcgtgctcgaatag) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT7R
Plasmid#221829PurposePlasmid to express gRNA (ggcgagggagagctttctct) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-for-dSERT
Plasmid#221830PurposePlasmid to express gRNA1 (cgaaatctgcgctctacttg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-for-dSERT
Plasmid#221831PurposePlasmid to express gRNA2 (gggattcgagcggcccgtcg) for editing at the beginning of Drosophila SERT coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1AR-7xsfGFP11-HA-HDR-donor
Plasmid#221832PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1AR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1AR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2BR-7xsfGFP11-HA-HDR-donor
Plasmid#221833PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT2BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_2xFlag-dSERT-HDR-donor-HDR
Plasmid#221835PurposeDonor plasmid for inserting 2xFLAG at the beginning of Drosophila SERT coding frameDepositorInsert2xFLAG with dSERT homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT7R-7xGFP11-HA
Plasmid#221836PurposePlasmid for generating 10xUAS-5-HT7R-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT1BR-7xsfGFP11-HA-HDR-donor
Plasmid#221837PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT1BR coding frameDepositorInsert7xGFP11-HA donor with 5-HT1BR homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformD)-7xsfGFP11-HA-HDR-donor
Plasmid#221838PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoform D) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTwist Amp_d5-HT2AR(isoformBFH)-7xsfGFP11-HA-HDR-donor
Plasmid#221839PurposeDonor plasmid for inserting 7xGFP11-HA at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsert7xGFP11-HA donor with 5-HT2AR (isoforms BFH) homology arms
UseCRISPRExpressionInsect and MammalianAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pACUH 5-HT2BR-7xGFP11-HA
Plasmid#221840PurposePlasmid for generating 10xUAS-5-HT2BR-7xGFP11-HA transgenic flies with attP/attB integration. It carries the attB sequence.DepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3
Plasmid#240233PurposeExpression of Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertMyc-BirA*G3
ExpressionInsectPromoterMTAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23012
Plasmid#109180PurposePlasmid for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacA-23122
Plasmid#109181PurposePlasmid for expression of N-terminally 3xFLAG-tagged proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneTags3xFLAGExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23003
Plasmid#109183PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGS-BacD-23004
Plasmid#109184PurposePlasmid donor for expression of proteins under the control of a minimal HSP70 promoter in baculovirus/insect cell systemsDepositorTypeEmpty backboneExpressionInsectPromoterminimal HSP70 promoterAvailable SinceJuly 29, 2025AvailabilityAcademic Institutions and Nonprofits only