1,748 results
-
Plasmid#200038PurposePrig-3 zif-1 SL2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of zif RFPDepositorInsertZIF (zif-1 Nematode)
UseTagsmCherryExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorInsertzif-1 (zif-1 Nematode)
UseTagsEBFPExpressionWormMutationPromoterPrig-3Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS110
Plasmid#215674PurposeSplit hygromycinR landing pad insertion plasmid for ChrIIIDepositorInsert5'HA + synthetic guide site3 + 3'ΔHygR:unc-54 3' UTR + lox2272 + SEC + lox2272 + 3'HA
UseCRISPR and Cre/LoxTagsExpressionWormMutation3' ∆HYGR is promoterless and encodes aa60-341PromoterAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS160
Plasmid#215682PurposeGuide only plasmid targeting chrI split hygromycinR landing padDepositorInsertU6p::GTTTGAGTAGAGCACTCAGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRTagsExpressionWormMutationPromoterAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSAH64 - [AFDp | gfp | tbb-2 UTR]
Plasmid#200338Purposegfp BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV06 [punc-17::SNG-1::CRY2(535)]
Plasmid#197597PurposeExpression of SNG-1::CRY2olig(535) in cholinergic motor neurons of C. elegansDepositorUseTagsExpressionWormMutationE490GPromoterAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH50 - [PVQp | gfp | tbb-2 UTR]
Plasmid#200326Purposegfp BioPart for PVQ neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVQp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00003755, nlp-17Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH47 - [ADLp | mScarlet | tbb-2 UTR]
Plasmid#200323PurposemScarlet BioPart for ADL neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[ADLp | wrmscarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011644, T09B9.3Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH80 - [AWAp | gfp | tbb-2 UTR]
Plasmid#200354Purposegfp BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH83 - [AVHp | wrmScarlet | tbb-2 UTR]
Plasmid#200357PurposemScarlet BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH79 - [AWAp | wrmScarlet | tbb-2 UTR]
Plasmid#200353PurposemScarlet BioPart for AWA neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWAp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006109, str-44Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH63 - [AFDp | wrmScarlet | tbb-2 UTR]
Plasmid#200337PurposemScarlet BioPart for AFD neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AFDp | wrmScarlet | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00001535, gcy-8Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZCS41 (U6p::GCGAAGTGACGGTAGACCGT)
Plasmid#193050PurposeEncodes guide RNA expression targeting PX740 landing padDepositorInsertGuide RNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available sinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB96
Plasmid#199316PurposeMosSCI insertion of flp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR at ttTi5605DepositorInsertflp-18p::lox2272::mTagBFP2::tbb-2 3'UTR::lox2272::ACR1::SL2::jRGECO1a::let-858 3'UTR
UseTagsExpressionWormMutationmTagBFP2 from pJJR81, C. elegans codon optimized …Promoterflp-18Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB91
Plasmid#199319PurposeCombine with Gal4 to direct ACR1 expressionDepositorInsert15xUAS::delta pes-10::::ACR1::let-858 3'UTR
UseTagsExpressionWormMutationPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB88
Plasmid#199321PurposeCombine with Gal4 to direct TeNL expressionDepositorInsert15xUAS::delta pes-10::::TeNL::let-858 3'UTR
UseTagsExpressionWormMutationKD for calcium is 250 nM, 1 synthetic intronPromoter15xUAS::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNMSB109
Plasmid#199322PurposeCombine with Gal4 to direct CaMBI 300 expressionDepositorInsert15xUAS::delta pes-10::::CaMBI::let-858 3'UTR
UseTagsExpressionWormMutationOrange CaMBI with 300 nM KD for calciumPromoter15xUAS:::delta pes-10Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT318
Plasmid#204508Purposerpl-21 promoter-driven C04F12.1 construct tagged with 2xHA for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsertrpl-21p::2xHA::C04F12.1 (C. elegans)
UseTags2xHAExpressionWormMutationPromoterrpl-21 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIT246
Plasmid#204507Purposecsr-1 construct tagged with 2xFLAG for MosSCI integration at locus ttTi5605 on Chr II in nematodeDepositorInsert2xFLAG::csr-1 (C. elegans) (csr-1 Nematode)
UseTags2xFLAGExpressionWormMutationPromotercsr-1 (C. elegans)Available sinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmCardinal-T2A-HO1
Plasmid#197249PurposeExpresses the protein of wmCardinal-T2A-HO1 in neurons of C. elegansDepositorInsertwmCardinal-T2A-HO1
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmiRFP720-T2A-HO1
Plasmid#197248PurposeExpresses the protein of wmiRFP720-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP720-T2A-HO1
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSF11-wmNeonGreen
Plasmid#197242PurposeExpresses the protein of wNeonGreen in neurons of C eleganDepositorInsertwmNeonGreen
UseTagsExpressionWormMutationPromoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJR017
Plasmid#198835PurposeIn vivo blocking of synaptic signaling through Tetanus toxin mediated cleavage of synptobrevin proteins.DepositorInsert15xUAS::TeTX-SL2-mKate::let-858 3'UTR
UseTagsExpressionWormMutationPromoterAvailable sinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH86 - [AWCp | gfp | tbb-2 UTR]
Plasmid#200360Purposegfp BioPart for AWC neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AWCp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00012770, srt-47Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH82 - [PVTp | gfp | tbb-2 UTR]
Plasmid#200356Purposegfp BioPart for PVT neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[PVTp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00006979, zig-2Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSAH84 - [AVHp | gfp | tbb-2 UTR]
Plasmid#200358Purposegfp BioPart for AVH neurons. (1) Mark neurons or (2) cell-specific expression of transgenes (N or C-terminal fusions, or untagged). Compatible with single-copy insertion (MosTI) or arrays.DepositorInsert[AVHp | gfp | tbb-2 UTR]
UseTagsExpressionWormMutationPromoterWBGene00011327, hlh-34Available sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only